Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2668957..2669100 | Replicon | chromosome |
Accession | NZ_CP117307 | ||
Organism | Salmonella enterica subsp. enterica serovar Derby strain RM004 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2668959..2669062 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2668957..2669100 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PQQ01_RS12905 | 2664404..2664673 | + | 270 | WP_077248370.1 | hypothetical protein | - |
PQQ01_RS12910 | 2664839..2664979 | + | 141 | WP_048348799.1 | hypothetical protein | - |
PQQ01_RS12915 | 2665125..2665652 | - | 528 | Protein_2528 | transposase | - |
PQQ01_RS12920 | 2665672..2665764 | - | 93 | WP_230855586.1 | hypothetical protein | - |
PQQ01_RS12925 | 2665794..2668214 | - | 2421 | WP_048348800.1 | type III secretion system effector SspH3 | - |
PQQ01_RS12930 | 2668387..2668470 | - | 84 | Protein_2531 | phage tail protein | - |
PQQ01_RS12935 | 2668559..2668828 | + | 270 | WP_017441955.1 | tyrosine-type recombinase/integrase | - |
- | 2668957..2669100 | + | 144 | - | - | Antitoxin |
- | 2668959..2669062 | - | 104 | - | - | Toxin |
PQQ01_RS12940 | 2669202..2669555 | - | 354 | WP_023232537.1 | YebY family protein | - |
PQQ01_RS12945 | 2669572..2670447 | - | 876 | WP_072103686.1 | copper homeostasis membrane protein CopD | - |
PQQ01_RS12950 | 2670448..2670822 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
PQQ01_RS12955 | 2670960..2671190 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
PQQ01_RS12960 | 2671298..2671954 | + | 657 | WP_274890667.1 | carbon-nitrogen hydrolase family protein | - |
PQQ01_RS12965 | 2671978..2672676 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270441 NZ_CP117307:c2669062-2668959 [Salmonella enterica subsp. enterica serovar Derby]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT270441 NZ_CP117307:2668957-2669100 [Salmonella enterica subsp. enterica serovar Derby]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG