Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2008364..2008507 | Replicon | chromosome |
Accession | NZ_CP117301 | ||
Organism | Salmonella enterica subsp. enterica serovar Derby strain RM006 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2008402..2008505 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2008364..2008507 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PQP83_RS09650 | 2004788..2005486 | - | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
PQP83_RS09655 | 2005510..2006166 | - | 657 | WP_274896544.1 | carbon-nitrogen hydrolase family protein | - |
PQP83_RS09660 | 2006274..2006504 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
PQP83_RS09665 | 2006642..2007016 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
PQP83_RS09670 | 2007017..2007892 | + | 876 | WP_072103686.1 | copper homeostasis membrane protein CopD | - |
PQP83_RS09675 | 2007909..2008262 | + | 354 | WP_023232537.1 | YebY family protein | - |
- | 2008364..2008507 | - | 144 | - | - | Antitoxin |
- | 2008402..2008505 | + | 104 | - | - | Toxin |
PQP83_RS09680 | 2008636..2008905 | - | 270 | WP_017441955.1 | tyrosine-type recombinase/integrase | - |
PQP83_RS09685 | 2008994..2009077 | + | 84 | Protein_1892 | phage tail protein | - |
PQP83_RS09690 | 2009250..2011670 | + | 2421 | WP_048348800.1 | type III secretion system effector SspH3 | - |
PQP83_RS09695 | 2011695..2011805 | + | 111 | Protein_1894 | DUF4113 domain-containing protein | - |
PQP83_RS09700 | 2011812..2012339 | + | 528 | Protein_1895 | transposase | - |
PQP83_RS09705 | 2012485..2012625 | - | 141 | WP_048348799.1 | hypothetical protein | - |
PQP83_RS09710 | 2012791..2013060 | - | 270 | WP_077248370.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270410 NZ_CP117301:2008402-2008505 [Salmonella enterica subsp. enterica serovar Derby]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT270410 NZ_CP117301:c2008507-2008364 [Salmonella enterica subsp. enterica serovar Derby]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG