Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3011941..3012084 | Replicon | chromosome |
Accession | NZ_CP117299 | ||
Organism | Salmonella enterica subsp. enterica serovar Mbandaka strain SM-F22S |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3011943..3012046 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3011941..3012084 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PH350_RS14705 | 3007395..3007664 | + | 270 | WP_077907250.1 | hypothetical protein | - |
PH350_RS14710 | 3007830..3007970 | + | 141 | WP_031615664.1 | hypothetical protein | - |
PH350_RS14715 | 3008116..3008644 | - | 529 | Protein_2869 | transposase | - |
PH350_RS14720 | 3008664..3008756 | - | 93 | WP_230855586.1 | hypothetical protein | - |
PH350_RS14725 | 3008786..3011206 | - | 2421 | WP_024149295.1 | type III secretion system effector SspH3 | - |
PH350_RS14730 | 3011380..3011463 | - | 84 | Protein_2872 | phage tail protein | - |
PH350_RS14735 | 3011475..3011822 | + | 348 | Protein_2873 | tyrosine-type recombinase/integrase | - |
- | 3011941..3012084 | + | 144 | - | - | Antitoxin |
- | 3011943..3012046 | - | 104 | - | - | Toxin |
PH350_RS14740 | 3012187..3012540 | - | 354 | WP_017441954.1 | YebY family protein | - |
PH350_RS14745 | 3012557..3013432 | - | 876 | WP_017441953.1 | copper homeostasis membrane protein CopD | - |
PH350_RS14750 | 3013433..3013807 | - | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
PH350_RS14755 | 3013945..3014175 | + | 231 | WP_017441952.1 | DNA polymerase III subunit theta | - |
PH350_RS14760 | 3014283..3014939 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
PH350_RS14765 | 3014963..3015661 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 3008116..3008454 | 338 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270390 NZ_CP117299:c3012046-3011943 [Salmonella enterica subsp. enterica serovar Mbandaka]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT270390 NZ_CP117299:3011941-3012084 [Salmonella enterica subsp. enterica serovar Mbandaka]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAAGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAAGTTTTCCAGTTTG