Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2130729..2130872 | Replicon | chromosome |
Accession | NZ_CP117292 | ||
Organism | Salmonella enterica subsp. enterica serovar Typhi strain S4 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2130768..2130870 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2130729..2130872 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PRW96_RS10225 (PRW96_10225) | 2127153..2127851 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
PRW96_RS10230 (PRW96_10230) | 2127875..2128531 | - | 657 | WP_000100250.1 | carbon-nitrogen hydrolase family protein | - |
PRW96_RS10235 (PRW96_10235) | 2128639..2128869 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
PRW96_RS10240 (PRW96_10240) | 2129007..2129381 | + | 375 | WP_001681742.1 | CopC domain-containing protein YobA | - |
PRW96_RS10245 (PRW96_10245) | 2129382..2130257 | + | 876 | WP_000979693.1 | copper homeostasis membrane protein CopD | - |
PRW96_RS10250 (PRW96_10250) | 2130274..2130627 | + | 354 | WP_000722366.1 | YebY family protein | - |
- | 2130729..2130872 | - | 144 | - | - | Antitoxin |
- | 2130768..2130870 | + | 103 | - | - | Toxin |
PRW96_RS10255 (PRW96_10255) | 2130991..2131299 | - | 309 | Protein_1992 | tyrosine-type recombinase/integrase | - |
PRW96_RS10260 (PRW96_10260) | 2131298..2131659 | - | 362 | Protein_1993 | recombinase RecT | - |
PRW96_RS10265 (PRW96_10265) | 2131660..2131770 | + | 111 | Protein_1994 | replication protein | - |
PRW96_RS10270 (PRW96_10270) | 2131783..2132178 | + | 396 | Protein_1995 | DUF977 family protein | - |
PRW96_RS10275 (PRW96_10275) | 2132464..2133594 | - | 1131 | WP_000529513.1 | GGDEF domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 2125065..2162059 | 36994 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T270276 NZ_CP117292:2130768-2130870 [Salmonella enterica subsp. enterica serovar Typhi]
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT270276 NZ_CP117292:c2130872-2130729 [Salmonella enterica subsp. enterica serovar Typhi]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG