Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1939657..1939800 | Replicon | chromosome |
Accession | NZ_CP117290 | ||
Organism | Salmonella enterica subsp. enterica serovar Typhi strain S6 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1939696..1939798 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1939657..1939800 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PRW98_RS09325 (PRW98_09325) | 1936081..1936779 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
PRW98_RS09330 (PRW98_09330) | 1936803..1937459 | - | 657 | WP_000100250.1 | carbon-nitrogen hydrolase family protein | - |
PRW98_RS09335 (PRW98_09335) | 1937567..1937797 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
PRW98_RS09340 (PRW98_09340) | 1937935..1938309 | + | 375 | WP_001681742.1 | CopC domain-containing protein YobA | - |
PRW98_RS09345 (PRW98_09345) | 1938310..1939185 | + | 876 | WP_000979693.1 | copper homeostasis membrane protein CopD | - |
PRW98_RS09350 (PRW98_09350) | 1939202..1939555 | + | 354 | WP_000722366.1 | YebY family protein | - |
- | 1939657..1939800 | - | 144 | - | - | Antitoxin |
- | 1939696..1939798 | + | 103 | - | - | Toxin |
PRW98_RS09355 (PRW98_09355) | 1939919..1940227 | - | 309 | Protein_1825 | tyrosine-type recombinase/integrase | - |
PRW98_RS09360 (PRW98_09360) | 1940226..1940587 | - | 362 | Protein_1826 | recombinase RecT | - |
PRW98_RS09365 (PRW98_09365) | 1940588..1940698 | + | 111 | Protein_1827 | replication protein | - |
PRW98_RS09370 (PRW98_09370) | 1940711..1941106 | + | 396 | Protein_1828 | DUF977 family protein | - |
PRW98_RS09375 (PRW98_09375) | 1941392..1942522 | - | 1131 | WP_000529513.1 | GGDEF domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 1933993..1970987 | 36994 | |
- | inside | Prophage | - | sopE2 | 1932315..1970987 | 38672 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T270244 NZ_CP117290:1939696-1939798 [Salmonella enterica subsp. enterica serovar Typhi]
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT270244 NZ_CP117290:c1939800-1939657 [Salmonella enterica subsp. enterica serovar Typhi]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG