Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1982116..1982261 | Replicon | chromosome |
Accession | NZ_CP117227 | ||
Organism | Klebsiella pneumoniae strain ATCC BAA2146 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1982152..1982254 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1982116..1982261 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PQQ24_RS11745 (PQQ24_11745) | 1977246..1979306 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
PQQ24_RS11750 (PQQ24_11750) | 1979310..1979969 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
PQQ24_RS11755 (PQQ24_11755) | 1980048..1980278 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
PQQ24_RS11760 (PQQ24_11760) | 1980391..1980765 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
PQQ24_RS11765 (PQQ24_11765) | 1980769..1981638 | + | 870 | WP_004189267.1 | copper homeostasis membrane protein CopD | - |
PQQ24_RS11770 (PQQ24_11770) | 1981655..1981993 | + | 339 | WP_004189269.1 | YebY family protein | - |
- | 1982116..1982261 | - | 146 | - | - | Antitoxin |
- | 1982152..1982254 | + | 103 | - | - | Toxin |
PQQ24_RS11775 (PQQ24_11775) | 1982628..1982771 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
PQQ24_RS11780 (PQQ24_11780) | 1982876..1983844 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
PQQ24_RS11785 (PQQ24_11785) | 1984001..1984654 | + | 654 | WP_004189273.1 | protein-serine/threonine phosphatase | - |
PQQ24_RS11790 (PQQ24_11790) | 1984651..1984842 | - | 192 | WP_002911395.1 | YebW family protein | - |
PQQ24_RS11795 (PQQ24_11795) | 1984940..1985179 | - | 240 | WP_002911393.1 | YebV family protein | - |
PQQ24_RS11800 (PQQ24_11800) | 1985295..1986728 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T270100 NZ_CP117227:1982152-1982254 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT270100 NZ_CP117227:c1982261-1982116 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT