Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 684437..684554 | Replicon | chromosome |
Accession | NC_017564 | ||
Organism | Yersinia enterocolitica subsp. palearctica Y11 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 684459..684552 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 684437..684554 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
Y11_RS03005 | 680052..681008 | + | 957 | WP_005163605.1 | prolyl aminopeptidase | - |
Y11_RS03010 | 681058..681291 | - | 234 | WP_004389928.1 | DNA polymerase III subunit theta | - |
Y11_RS03015 | 681674..682183 | + | 510 | WP_005163604.1 | non-heme ferritin | - |
Y11_RS03020 | 682574..682960 | + | 387 | WP_005163603.1 | CopC domain-containing protein YobA | - |
Y11_RS03025 | 682962..683846 | + | 885 | WP_005163602.1 | copper homeostasis membrane protein CopD | - |
Y11_RS03030 | 683943..684284 | + | 342 | WP_005163587.1 | YebY family protein | - |
- | 684437..684554 | - | 118 | - | - | Antitoxin |
- | 684459..684552 | + | 94 | - | - | Toxin |
Y11_RS03035 | 684610..685680 | - | 1071 | WP_023161015.1 | tyrosine-type recombinase/integrase | - |
Y11_RS03040 | 685921..686736 | + | 816 | WP_005163581.1 | hypothetical protein | - |
Y11_RS21425 | 686821..687042 | - | 222 | WP_005163580.1 | DNA-binding transcriptional regulator | - |
Y11_RS03045 | 687135..688277 | - | 1143 | WP_005163579.1 | phage late control D family protein | - |
Y11_RS03050 | 688274..688726 | - | 453 | WP_005163578.1 | phage tail protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Integrative and Conjugative Element | - | ystA | 583300..835662 | 252362 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 94 bp
>T27006 NC_017564:684459-684552 [Yersinia enterocolitica subsp. palearctica Y11]
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTTTTTT
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTTTTTT
Antitoxin
Download Length: 118 bp
>AT27006 NC_017564:c684554-684437 [Yersinia enterocolitica subsp. palearctica Y11]
ATAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAACGTAGGCTTGTTCAGCCATACTCTTTAAGAGTAG
ATAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCA
TTAACGTAGGCTTGTTCAGCCATACTCTTTAAGAGTAG