Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1650967..1651080 | Replicon | chromosome |
Accession | NZ_CP115895 | ||
Organism | Kalamiella piersonii strain URMC-2103A041 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1650980..1651080 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1650967..1651080 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PG877_RS07995 (PG877_07995) | 1646109..1648172 | + | 2064 | WP_271153036.1 | prolyl oligopeptidase family serine peptidase | - |
PG877_RS08000 (PG877_08000) | 1648166..1648834 | - | 669 | WP_271153037.1 | exodeoxyribonuclease X | - |
PG877_RS08005 (PG877_08005) | 1648838..1649068 | - | 231 | WP_120453863.1 | DNA polymerase III subunit theta | - |
PG877_RS08010 (PG877_08010) | 1649220..1649585 | + | 366 | WP_271153038.1 | copper homeostasis periplasmic binding protein CopC | - |
PG877_RS08015 (PG877_08015) | 1649589..1650464 | + | 876 | WP_148104576.1 | copper homeostasis membrane protein CopD | - |
PG877_RS08020 (PG877_08020) | 1650500..1650847 | + | 348 | WP_269950324.1 | YebY family protein | - |
- | 1650967..1651080 | - | 114 | - | - | Antitoxin |
- | 1650980..1651080 | + | 101 | - | - | Toxin |
PG877_RS08025 (PG877_08025) | 1651631..1651807 | + | 177 | WP_120453869.1 | general stress protein | - |
PG877_RS08030 (PG877_08030) | 1652010..1652381 | + | 372 | WP_120453871.1 | anti-adapter protein IraP | - |
PG877_RS08035 (PG877_08035) | 1652450..1652776 | - | 327 | WP_120453873.1 | four-helix bundle copper-binding protein | - |
PG877_RS08040 (PG877_08040) | 1653122..1653979 | + | 858 | WP_271153039.1 | manganese catalase family protein | - |
PG877_RS08045 (PG877_08045) | 1654302..1654508 | - | 207 | WP_120453877.1 | hypothetical protein | - |
PG877_RS08050 (PG877_08050) | 1654903..1655562 | + | 660 | WP_120453879.1 | metallophosphoesterase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 101 bp
>T267475 NZ_CP115895:1650980-1651080 [Kalamiella piersonii]
GGCAAGGCGAAATCGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTACAAGAGCCATTTCCCTGGACCGAATACAGG
AATCGTGTTCGGTCTTTTTTT
GGCAAGGCGAAATCGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTACAAGAGCCATTTCCCTGGACCGAATACAGG
AATCGTGTTCGGTCTTTTTTT
Antitoxin
Download Length: 114 bp
>AT267475 NZ_CP115895:c1651080-1650967 [Kalamiella piersonii]
AAAAAAAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGTAGAGCCGTGCGCTAAAAGTTGGCATTAA
TGCAGGCGATTTCGCCTTGCCAGTTAAGATTAGA
AAAAAAAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGTAGAGCCGTGCGCTAAAAGTTGGCATTAA
TGCAGGCGATTTCGCCTTGCCAGTTAAGATTAGA