Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1966638..1966783 | Replicon | chromosome |
Accession | NZ_CP115707 | ||
Organism | Klebsiella pneumoniae strain CPE16 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1966674..1966776 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1966638..1966783 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PGD48_RS09695 | 1961768..1963828 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
PGD48_RS09700 | 1963832..1964491 | - | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
PGD48_RS09705 | 1964570..1964800 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
PGD48_RS09710 | 1964913..1965287 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
PGD48_RS09715 | 1965291..1966160 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
PGD48_RS09720 | 1966177..1966515 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1966638..1966783 | - | 146 | - | - | Antitoxin |
- | 1966674..1966776 | + | 103 | - | - | Toxin |
PGD48_RS09725 | 1967152..1967295 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
PGD48_RS09730 | 1967400..1968368 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
PGD48_RS09735 | 1968525..1969178 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
PGD48_RS09740 | 1969175..1969366 | - | 192 | WP_002911395.1 | YebW family protein | - |
PGD48_RS09745 | 1969464..1969703 | - | 240 | WP_002911393.1 | YebV family protein | - |
PGD48_RS09750 | 1969819..1971252 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1893583..1979854 | 86271 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T267305 NZ_CP115707:1966674-1966776 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT267305 NZ_CP115707:c1966783-1966638 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT