Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2726412..2726615 | Replicon | chromosome |
Accession | NZ_CP115150 | ||
Organism | Enterobacter hormaechei subsp. xiangfangensis strain MDCL 3 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2726505..2726608 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2726412..2726615 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
MUY00_RS12970 (MUY00_12970) | 2722949..2723611 | - | 663 | WP_058656540.1 | exodeoxyribonuclease X | - |
MUY00_RS12975 (MUY00_12975) | 2723636..2724286 | - | 651 | WP_058656541.1 | carbon-nitrogen hydrolase family protein | - |
MUY00_RS12980 (MUY00_12980) | 2724398..2724628 | - | 231 | WP_003859784.1 | DNA polymerase III subunit theta | - |
MUY00_RS12985 (MUY00_12985) | 2724766..2725137 | + | 372 | WP_003859785.1 | CopC domain-containing protein YobA | - |
MUY00_RS12990 (MUY00_12990) | 2725139..2726008 | + | 870 | WP_003859786.1 | copper homeostasis membrane protein CopD | - |
MUY00_RS12995 (MUY00_12995) | 2726025..2726363 | + | 339 | WP_003859787.1 | YebY family protein | - |
- | 2726412..2726615 | - | 204 | - | - | Antitoxin |
- | 2726505..2726608 | + | 104 | - | - | Toxin |
MUY00_RS13000 (MUY00_13000) | 2726686..2727771 | - | 1086 | WP_058691373.1 | phage integrase Arm DNA-binding domain-containing protein | - |
MUY00_RS13005 (MUY00_13005) | 2727740..2728012 | - | 273 | WP_023300430.1 | excisionase | - |
MUY00_RS13010 (MUY00_13010) | 2728215..2728427 | + | 213 | WP_045617122.1 | hypothetical protein | - |
MUY00_RS13015 (MUY00_13015) | 2728433..2728672 | - | 240 | WP_058656543.1 | DUF4222 domain-containing protein | - |
MUY00_RS13020 (MUY00_13020) | 2728672..2728890 | - | 219 | WP_058656544.1 | TraR/DksA family transcriptional regulator | - |
MUY00_RS13025 (MUY00_13025) | 2729209..2729427 | - | 219 | WP_032621601.1 | hypothetical protein | - |
MUY00_RS13030 (MUY00_13030) | 2729424..2729975 | - | 552 | WP_022651070.1 | phage N-6-adenine-methyltransferase | - |
MUY00_RS13035 (MUY00_13035) | 2729972..2730124 | - | 153 | WP_022651071.1 | DUF1317 family protein | - |
MUY00_RS13040 (MUY00_13040) | 2730121..2730549 | - | 429 | WP_022651072.1 | hypothetical protein | - |
MUY00_RS13045 (MUY00_13045) | 2730546..2731226 | - | 681 | WP_022651073.1 | YqaJ viral recombinase family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | gtrB / gtrA | 2660018..2791876 | 131858 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T267050 NZ_CP115150:2726505-2726608 [Enterobacter hormaechei subsp. xiangfangensis]
GGCAAGGCGATTGAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTGAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 204 bp
>AT267050 NZ_CP115150:c2726615-2726412 [Enterobacter hormaechei subsp. xiangfangensis]
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTCAATCGCCTTGCCCTTTAAGAATAGATGACGACGTCAGGTTTTCCAGTCCACAGTAAAAGTG
GTCTGAAAAAAAGCGTCAGAACATCACTAAATGTGAAAAACCGC
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTCAATCGCCTTGCCCTTTAAGAATAGATGACGACGTCAGGTTTTCCAGTCCACAGTAAAAGTG
GTCTGAAAAAAAGCGTCAGAACATCACTAAATGTGAAAAACCGC