Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2410197..2410286 | Replicon | chromosome |
Accession | NZ_CP114062 | ||
Organism | Rouxiella badensis strain DAR84756 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2410197..2410286 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2410197..2410286 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
O1V65_RS11095 (O1V65_11090) | 2405748..2406017 | - | 270 | WP_269130490.1 | hypothetical protein | - |
O1V65_RS11100 (O1V65_11095) | 2406537..2406785 | + | 249 | WP_017493706.1 | biofilm development regulator YmgB/AriR family protein | - |
O1V65_RS11105 (O1V65_11100) | 2406873..2407289 | - | 417 | WP_017493707.1 | NUDIX hydrolase | - |
O1V65_RS11110 (O1V65_11105) | 2408124..2408581 | - | 458 | Protein_2151 | integrase core domain-containing protein | - |
O1V65_RS11115 (O1V65_11110) | 2408904..2409179 | + | 276 | WP_084912825.1 | hypothetical protein | - |
O1V65_RS11120 (O1V65_11115) | 2409169..2409366 | + | 198 | WP_017493711.1 | DUF1737 domain-containing protein | - |
O1V65_RS11125 (O1V65_11120) | 2409904..2410140 | + | 237 | WP_227955263.1 | integrase | - |
- | 2410197..2410286 | - | 90 | - | - | Toxin |
O1V65_RS11130 (O1V65_11125) | 2410497..2410832 | - | 336 | WP_017493800.1 | YebY family protein | - |
O1V65_RS11135 (O1V65_11130) | 2410893..2411777 | - | 885 | WP_017493799.1 | copper homeostasis membrane protein CopD | - |
O1V65_RS11140 (O1V65_11135) | 2411782..2412165 | - | 384 | WP_269130491.1 | copper homeostasis periplasmic binding protein CopC | - |
O1V65_RS11145 (O1V65_11140) | 2412393..2412899 | - | 507 | WP_017493797.1 | non-heme ferritin | - |
O1V65_RS11150 (O1V65_11145) | 2413304..2413534 | + | 231 | WP_084912439.1 | DNA polymerase III subunit theta | - |
O1V65_RS11155 (O1V65_11150) | 2413572..2414525 | - | 954 | WP_017491913.1 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 2408306..2408581 | 275 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 90 bp
>T266240 NZ_CP114062:c2410286-2410197 [Rouxiella badensis]
GCCTGCATCAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTATTCG
GTCTTTTTTT
GCCTGCATCAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGTATTCG
GTCTTTTTTT
Antitoxin
Download Length: 90 bp
>AT266240 NZ_CP114062:2410197-2410286 [Rouxiella badensis]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TGATGCAGGC
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TGATGCAGGC