Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1985274..1985417 | Replicon | chromosome |
| Accession | NZ_CP113539 | ||
| Organism | Salmonella enterica strain FFL | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1985313..1985415 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1985274..1985417 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OXV09_RS09480 | 1981698..1982396 | - | 699 | WP_023255939.1 | exodeoxyribonuclease X | - |
| OXV09_RS09485 | 1982420..1983076 | - | 657 | WP_023245437.1 | carbon-nitrogen hydrolase family protein | - |
| OXV09_RS09490 | 1983184..1983414 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| OXV09_RS09495 | 1983552..1983926 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| OXV09_RS09500 | 1983927..1984802 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| OXV09_RS09505 | 1984819..1985172 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 1985274..1985417 | - | 144 | - | - | Antitoxin |
| - | 1985313..1985415 | + | 103 | - | - | Toxin |
| OXV09_RS09510 | 1985555..1986634 | - | 1080 | WP_058107134.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| OXV09_RS09515 | 1986667..1987818 | - | 1152 | Protein_1858 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| OXV09_RS09520 | 1987807..1987998 | + | 192 | Protein_1859 | glycoside hydrolase family 19 protein | - |
| OXV09_RS09525 | 1988052..1988585 | + | 534 | WP_023256014.1 | DUF2514 domain-containing protein | - |
| OXV09_RS09530 | 1988842..1989009 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| OXV09_RS09535 | 1989074..1989262 | - | 189 | WP_001034748.1 | hypothetical protein | - |
| OXV09_RS09540 | 1989317..1989577 | + | 261 | Protein_1863 | DUF1441 family protein | - |
| OXV09_RS09545 | 1989579..1989794 | + | 216 | Protein_1864 | shikimate transporter | - |
| OXV09_RS09550 | 1989804..1990091 | + | 288 | Protein_1865 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1962087..2005586 | 43499 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T265973 NZ_CP113539:1985313-1985415 [Salmonella enterica]
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT265973 NZ_CP113539:c1985417-1985274 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
