Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1984666..1984809 | Replicon | chromosome |
| Accession | NZ_CP113537 | ||
| Organism | Salmonella enterica strain YZY | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1984704..1984807 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1984666..1984809 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OXV04_RS09400 | 1981090..1981788 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| OXV04_RS09405 | 1981812..1982468 | - | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| OXV04_RS09410 | 1982576..1982806 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| OXV04_RS09415 | 1982944..1983318 | + | 375 | WP_000168396.1 | CopC domain-containing protein YobA | - |
| OXV04_RS09420 | 1983319..1984194 | + | 876 | WP_000979699.1 | copper homeostasis membrane protein CopD | - |
| OXV04_RS09425 | 1984211..1984564 | + | 354 | WP_126524015.1 | YebY family protein | - |
| - | 1984666..1984809 | - | 144 | - | - | Antitoxin |
| - | 1984704..1984807 | + | 104 | - | - | Toxin |
| OXV04_RS09430 | 1984938..1985588 | - | 651 | Protein_1841 | tyrosine-type recombinase/integrase | - |
| OXV04_RS09435 | 1985599..1985904 | + | 306 | WP_206519696.1 | hypothetical protein | - |
| OXV04_RS09440 | 1985861..1986064 | + | 204 | Protein_1843 | phage tail protein | - |
| OXV04_RS09445 | 1986236..1986391 | + | 156 | Protein_1844 | phage tail protein | - |
| OXV04_RS09450 | 1986497..1986829 | + | 333 | WP_061383450.1 | DUF1353 domain-containing protein | - |
| OXV04_RS09455 | 1986878..1986987 | + | 110 | Protein_1846 | tail fiber assembly protein | - |
| OXV04_RS09460 | 1987515..1987703 | - | 189 | Protein_1847 | tail fiber assembly protein | - |
| OXV04_RS09465 | 1987699..1988469 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| OXV04_RS09470 | 1988539..1988637 | + | 99 | Protein_1849 | DUF4113 domain-containing protein | - |
| OXV04_RS09475 | 1988960..1989088 | + | 129 | Protein_1850 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1962794..2015775 | 52981 | |
| - | inside | Prophage | - | sopE2 | 1962794..2028702 | 65908 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T265940 NZ_CP113537:1984704-1984807 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT265940 NZ_CP113537:c1984809-1984666 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
