Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1954235..1954389 | Replicon | chromosome |
Accession | NZ_CP113534 | ||
Organism | Salmonella enterica strain ZYX |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1954273..1954376 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1954235..1954389 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OXV08_RS09275 | 1950659..1951357 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
OXV08_RS09280 | 1951381..1952037 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
OXV08_RS09285 | 1952145..1952375 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
OXV08_RS09290 | 1952513..1952887 | + | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
OXV08_RS09295 | 1952888..1953763 | + | 876 | WP_077908185.1 | copper homeostasis membrane protein CopD | - |
OXV08_RS09300 | 1953780..1954133 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 1954235..1954389 | - | 155 | - | - | Antitoxin |
- | 1954273..1954376 | + | 104 | - | - | Toxin |
OXV08_RS09305 | 1954507..1955430 | - | 924 | Protein_1816 | tyrosine-type recombinase/integrase | - |
OXV08_RS09310 | 1955694..1956155 | - | 462 | Protein_1817 | DNA breaking-rejoining protein | - |
OXV08_RS09315 | 1956144..1956335 | + | 192 | Protein_1818 | glycoside hydrolase family 19 protein | - |
OXV08_RS09320 | 1956389..1956922 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
OXV08_RS09325 | 1957179..1957346 | - | 168 | WP_000789530.1 | lytic enzyme | - |
OXV08_RS09330 | 1957411..1957599 | - | 189 | WP_001537366.1 | hypothetical protein | - |
OXV08_RS09335 | 1957654..1958145 | + | 492 | WP_000348539.1 | DUF1441 family protein | - |
OXV08_RS09340 | 1958132..1958699 | + | 568 | Protein_1823 | phage terminase large subunit family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 1948573..1975741 | 27168 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T265885 NZ_CP113534:1954273-1954376 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 155 bp
>AT265885 NZ_CP113534:c1954389-1954235 [Salmonella enterica]
TTTTAATCTAAATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGC
TAAAAGTTGGCATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
TTTTAATCTAAATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGC
TAAAAGTTGGCATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG