Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2019831..2019974 | Replicon | chromosome |
Accession | NZ_CP113364 | ||
Organism | Salmonella enterica subsp. enterica strain KNP01 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2019869..2019972 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2019831..2019974 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OU685_RS09875 | 2016253..2016951 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
OU685_RS09880 | 2016975..2017631 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
OU685_RS09885 | 2017739..2017969 | - | 231 | WP_017441952.1 | DNA polymerase III subunit theta | - |
OU685_RS09890 | 2018107..2018481 | + | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
OU685_RS09895 | 2018482..2019357 | + | 876 | WP_017441953.1 | copper homeostasis membrane protein CopD | - |
OU685_RS09900 | 2019374..2019727 | + | 354 | WP_017441954.1 | YebY family protein | - |
- | 2019831..2019974 | - | 144 | - | - | Antitoxin |
- | 2019869..2019972 | + | 104 | - | - | Toxin |
OU685_RS09905 | 2020093..2020440 | - | 348 | Protein_1934 | tyrosine-type recombinase/integrase | - |
OU685_RS09910 | 2020452..2020535 | + | 84 | Protein_1935 | phage tail protein | - |
OU685_RS09915 | 2020709..2023129 | + | 2421 | WP_024149295.1 | type III secretion system effector SspH3 | - |
OU685_RS09920 | 2023271..2023799 | + | 529 | Protein_1937 | transposase | - |
OU685_RS09925 | 2023945..2024085 | - | 141 | WP_031615664.1 | hypothetical protein | - |
OU685_RS09930 | 2024251..2024520 | - | 270 | WP_077907250.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 2023461..2023799 | 338 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T265684 NZ_CP113364:2019869-2019972 [Salmonella enterica subsp. enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT265684 NZ_CP113364:c2019974-2019831 [Salmonella enterica subsp. enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAAGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAAGTTTTCCAGTTTG