Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2005724..2005869 | Replicon | chromosome |
Accession | NZ_CP113192 | ||
Organism | Klebsiella pneumoniae strain SXC4-2 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2005760..2005862 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2005724..2005869 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OT483_RS09925 | 2000854..2002914 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
OT483_RS09930 | 2002918..2003577 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
OT483_RS09935 | 2003656..2003886 | - | 231 | WP_102024692.1 | DNA polymerase III subunit theta | - |
OT483_RS09940 | 2003999..2004373 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
OT483_RS09945 | 2004377..2005246 | + | 870 | WP_023282759.1 | copper homeostasis membrane protein CopD | - |
OT483_RS09950 | 2005263..2005601 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2005724..2005869 | - | 146 | - | - | Antitoxin |
- | 2005760..2005862 | + | 103 | - | - | Toxin |
OT483_RS09955 | 2006237..2006380 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
OT483_RS09960 | 2006485..2007453 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
OT483_RS09965 | 2007610..2008263 | + | 654 | WP_009484457.1 | protein-serine/threonine phosphatase | - |
OT483_RS09970 | 2008260..2008451 | - | 192 | WP_002911395.1 | YebW family protein | - |
OT483_RS09975 | 2008549..2008788 | - | 240 | WP_002911393.1 | YebV family protein | - |
OT483_RS09980 | 2008904..2010337 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1933409..2018939 | 85530 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T265545 NZ_CP113192:2005760-2005862 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT265545 NZ_CP113192:c2005869-2005724 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT