Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2322894..2323039 | Replicon | chromosome |
Accession | NZ_CP113165 | ||
Organism | Klebsiella pneumoniae strain TSNTC10-1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2322930..2323032 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2322894..2323039 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OT484_RS11445 (OT484_11445) | 2318024..2320084 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
OT484_RS11450 (OT484_11450) | 2320088..2320747 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
OT484_RS11455 (OT484_11455) | 2320826..2321056 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
OT484_RS11460 (OT484_11460) | 2321169..2321543 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
OT484_RS11465 (OT484_11465) | 2321547..2322416 | + | 870 | WP_004189267.1 | copper homeostasis membrane protein CopD | - |
OT484_RS11470 (OT484_11470) | 2322433..2322771 | + | 339 | WP_004189269.1 | YebY family protein | - |
- | 2322894..2323039 | - | 146 | - | - | Antitoxin |
- | 2322930..2323032 | + | 103 | - | - | Toxin |
OT484_RS11475 (OT484_11475) | 2323406..2323549 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
OT484_RS11480 (OT484_11480) | 2323654..2324622 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
OT484_RS11485 (OT484_11485) | 2324779..2325432 | + | 654 | WP_004189273.1 | protein-serine/threonine phosphatase | - |
OT484_RS11490 (OT484_11490) | 2325429..2325620 | - | 192 | WP_002911395.1 | YebW family protein | - |
OT484_RS11495 (OT484_11495) | 2325718..2325957 | - | 240 | WP_002911393.1 | YebV family protein | - |
OT484_RS11500 (OT484_11500) | 2326073..2327506 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2257981..2327461 | 69480 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T265451 NZ_CP113165:2322930-2323032 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT265451 NZ_CP113165:c2323039-2322894 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT