Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2605845..2605988 | Replicon | chromosome |
Accession | NZ_CP111029 | ||
Organism | Salmonella sp. 2018103 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2605847..2605950 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2605845..2605988 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OLG56_RS12680 | 2601553..2601681 | - | 129 | Protein_2480 | helix-turn-helix domain-containing protein | - |
OLG56_RS12690 | 2602172..2602942 | + | 771 | WP_061377505.1 | transporter substrate-binding domain-containing protein | - |
OLG56_RS12695 | 2603040..2603135 | + | 96 | WP_024133706.1 | hypothetical protein | - |
OLG56_RS12700 | 2603381..2603566 | + | 186 | WP_071585801.1 | PagK family vesicle-borne virulence factor | - |
OLG56_RS12705 | 2603657..2603767 | - | 111 | Protein_2484 | tail fiber assembly protein | - |
OLG56_RS12710 | 2603771..2604148 | - | 378 | WP_061377511.1 | DUF1353 domain-containing protein | - |
OLG56_RS12715 | 2604167..2604817 | - | 651 | Protein_2486 | DUF4376 domain-containing protein | - |
OLG56_RS12720 | 2604741..2605046 | - | 306 | WP_235596648.1 | hypothetical protein | - |
OLG56_RS12725 | 2605057..2605707 | + | 651 | Protein_2488 | tyrosine-type recombinase/integrase | - |
- | 2605845..2605988 | + | 144 | - | - | Antitoxin |
- | 2605847..2605950 | - | 104 | - | - | Toxin |
OLG56_RS12730 | 2606090..2606443 | - | 354 | WP_000722368.1 | YebY family protein | - |
OLG56_RS12735 | 2606460..2607335 | - | 876 | WP_072275009.1 | copper homeostasis membrane protein CopD | - |
OLG56_RS12740 | 2607336..2607710 | - | 375 | WP_001664129.1 | CopC domain-containing protein YobA | - |
OLG56_RS12745 | 2607848..2608078 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
OLG56_RS12750 | 2608186..2608842 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
OLG56_RS12755 | 2608866..2609564 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 2582642..2631639 | 48997 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T264804 NZ_CP111029:c2605950-2605847 [Salmonella sp. 2018103]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT264804 NZ_CP111029:2605845-2605988 [Salmonella sp. 2018103]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG