Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1996244..1996389 | Replicon | chromosome |
Accession | NZ_CP110957 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain LC-395/19 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1996280..1996382 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1996244..1996389 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NPY03_RS09895 (NPY03_09895) | 1991374..1993434 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
NPY03_RS09900 (NPY03_09900) | 1993438..1994097 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
NPY03_RS09905 (NPY03_09905) | 1994176..1994406 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
NPY03_RS09910 (NPY03_09910) | 1994519..1994893 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
NPY03_RS09915 (NPY03_09915) | 1994897..1995766 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
NPY03_RS09920 (NPY03_09920) | 1995783..1996121 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1996244..1996389 | - | 146 | - | - | Antitoxin |
- | 1996280..1996382 | + | 103 | - | - | Toxin |
NPY03_RS09925 (NPY03_09925) | 1996757..1996900 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
NPY03_RS09930 (NPY03_09930) | 1997005..1997973 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
NPY03_RS09935 (NPY03_09935) | 1998130..1998783 | + | 654 | WP_002911396.1 | protein-serine/threonine phosphatase | - |
NPY03_RS09940 (NPY03_09940) | 1998780..1998971 | - | 192 | WP_002911395.1 | YebW family protein | - |
NPY03_RS09945 (NPY03_09945) | 1999069..1999308 | - | 240 | WP_002911393.1 | YebV family protein | - |
NPY03_RS09950 (NPY03_09950) | 1999424..2000857 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T264594 NZ_CP110957:1996280-1996382 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT264594 NZ_CP110957:c1996389-1996244 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT