Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3335321..3335466 | Replicon | chromosome |
Accession | NZ_CP110941 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain LC-1873/18 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3335328..3335430 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3335321..3335466 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NPY10_RS16500 (NPY10_16500) | 3330853..3332286 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
NPY10_RS16505 (NPY10_16505) | 3332402..3332641 | + | 240 | WP_002911393.1 | YebV family protein | - |
NPY10_RS16510 (NPY10_16510) | 3332739..3332930 | + | 192 | WP_002911395.1 | YebW family protein | - |
NPY10_RS16515 (NPY10_16515) | 3332927..3333580 | - | 654 | WP_002911396.1 | protein-serine/threonine phosphatase | - |
NPY10_RS16520 (NPY10_16520) | 3333737..3334705 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
NPY10_RS16525 (NPY10_16525) | 3334810..3334953 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 3335321..3335466 | + | 146 | - | - | Antitoxin |
- | 3335328..3335430 | - | 103 | - | - | Toxin |
NPY10_RS16530 (NPY10_16530) | 3335589..3335927 | - | 339 | WP_002911404.1 | YebY family protein | - |
NPY10_RS16535 (NPY10_16535) | 3335944..3336813 | - | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
NPY10_RS16540 (NPY10_16540) | 3336817..3337191 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
NPY10_RS16545 (NPY10_16545) | 3337304..3337534 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
NPY10_RS16550 (NPY10_16550) | 3337613..3338272 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
NPY10_RS16555 (NPY10_16555) | 3338276..3340336 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T264547 NZ_CP110941:c3335430-3335328 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT264547 NZ_CP110941:3335321-3335466 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT