Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2404197..2404291 | Replicon | chromosome |
Accession | NC_017265 | ||
Organism | Yersinia pestis biovar Medievalis str. Harbin 35 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2404198..2404291 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2404197..2404291 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
YPC_RS11240 | 2399390..2401469 | - | 2080 | Protein_2112 | flagellar biosynthesis protein FlhA | - |
YPC_RS11245 | 2401469..2402628 | - | 1160 | Protein_2113 | flagellar type III secretion system protein FlhB | - |
YPC_RS11250 | 2403160..2403618 | + | 459 | WP_002211098.1 | hypothetical protein | - |
YPC_RS11255 | 2403612..2403938 | + | 327 | WP_002211097.1 | DUF1493 family protein | - |
- | 2404197..2404291 | + | 95 | - | - | Antitoxin |
- | 2404198..2404291 | - | 94 | - | - | Toxin |
YPC_RS11265 | 2404461..2404802 | - | 342 | WP_002211095.1 | YebY family protein | - |
YPC_RS11270 | 2404899..2405783 | - | 885 | WP_002211094.1 | copper homeostasis membrane protein CopD | - |
YPC_RS11275 | 2405786..2406172 | - | 387 | WP_002211093.1 | CopC domain-containing protein YobA | - |
YPC_RS11280 | 2406569..2407078 | - | 510 | WP_002211092.1 | non-heme ferritin | - |
YPC_RS11285 | 2407479..2407709 | + | 231 | WP_002211091.1 | DNA polymerase III subunit theta | - |
YPC_RS11290 | 2407769..2408720 | - | 952 | Protein_2121 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 94 bp
>T26397 NC_017265:c2404291-2404198 [Yersinia pestis biovar Medievalis str. Harbin 35]
TAAGCCTACATTAATACCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATCAGGAATCGTA
TTCGGTCTTTTTTT
TAAGCCTACATTAATACCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATCAGGAATCGTA
TTCGGTCTTTTTTT
Antitoxin
Download Length: 95 bp
>AT26397 NC_017265:2404197-2404291 [Yersinia pestis biovar Medievalis str. Harbin 35]
TAAAAAAAGACCGAATACGATTCCTGATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGT
ATTAATGTAGGCTTA
TAAAAAAAGACCGAATACGATTCCTGATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGT
ATTAATGTAGGCTTA