Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1831266..1831411 | Replicon | chromosome |
Accession | NZ_CP110523 | ||
Organism | Klebsiella pneumoniae strain WS_29-2 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1831302..1831404 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1831266..1831411 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OM422_RS08915 | 1826396..1828456 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
OM422_RS08920 | 1828460..1829119 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
OM422_RS08925 | 1829198..1829428 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
OM422_RS08930 | 1829541..1829915 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
OM422_RS08935 | 1829919..1830788 | + | 870 | WP_023280292.1 | copper homeostasis membrane protein CopD | - |
OM422_RS08940 | 1830805..1831143 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1831266..1831411 | - | 146 | - | - | Antitoxin |
- | 1831302..1831404 | + | 103 | - | - | Toxin |
OM422_RS08945 | 1831780..1831923 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
OM422_RS08950 | 1832028..1832996 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
OM422_RS08955 | 1833153..1833536 | + | 384 | Protein_1745 | metallophosphoesterase | - |
OM422_RS08960 | 1833620..1834645 | + | 1026 | WP_001101446.1 | IS110 family transposase | - |
OM422_RS08965 | 1834940..1835908 | + | 969 | WP_072193960.1 | IS5 family transposase | - |
OM422_RS08970 | 1835964..1836245 | + | 282 | Protein_1748 | serine/threonine-protein phosphatase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1826429..1838274 | 11845 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T263896 NZ_CP110523:1831302-1831404 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT263896 NZ_CP110523:c1831411-1831266 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT