Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1910871..1911016 | Replicon | chromosome |
Accession | NZ_CP109614 | ||
Organism | Klebsiella sp. KP20-425-1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1910907..1911009 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1910871..1911016 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
OHJ17_RS09280 | 1906001..1908061 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
OHJ17_RS09285 | 1908065..1908724 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
OHJ17_RS09290 | 1908803..1909033 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
OHJ17_RS09295 | 1909146..1909520 | + | 375 | WP_039819395.1 | CopC domain-containing protein YobA | - |
OHJ17_RS09300 | 1909524..1910393 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
OHJ17_RS09305 | 1910410..1910748 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1910871..1911016 | - | 146 | - | - | Antitoxin |
- | 1910907..1911009 | + | 103 | - | - | Toxin |
OHJ17_RS09310 | 1911385..1911528 | - | 144 | WP_038431282.1 | Ecr family regulatory small membrane protein | - |
OHJ17_RS09315 | 1911633..1912601 | - | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
OHJ17_RS09320 | 1912758..1913411 | + | 654 | WP_024622748.1 | protein-serine/threonine phosphatase | - |
OHJ17_RS09325 | 1913408..1913599 | - | 192 | WP_002911395.1 | YebW family protein | - |
OHJ17_RS09330 | 1913697..1913936 | - | 240 | WP_002911393.1 | YebV family protein | - |
OHJ17_RS09335 | 1914052..1915485 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T261949 NZ_CP109614:1910907-1911009 [Klebsiella sp. KP20-425-1]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT261949 NZ_CP109614:c1911016-1910871 [Klebsiella sp. KP20-425-1]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT