Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2008621..2008766 | Replicon | chromosome |
| Accession | NZ_CP107010 | ||
| Organism | Salmonella enterica subsp. enterica serovar Paratyphi B strain SZ21B23 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2008661..2008764 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2008621..2008766 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OF884_RS09565 | 2005047..2005745 | - | 699 | WP_000944287.1 | exodeoxyribonuclease X | - |
| OF884_RS09570 | 2005769..2006425 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| OF884_RS09575 | 2006533..2006763 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| OF884_RS09580 | 2006901..2007275 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| OF884_RS09585 | 2007276..2008151 | + | 876 | WP_000979706.1 | copper homeostasis membrane protein CopD | - |
| OF884_RS09590 | 2008168..2008521 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2008621..2008766 | - | 146 | - | - | Antitoxin |
| - | 2008661..2008764 | + | 104 | - | - | Toxin |
| OF884_RS09595 | 2008894..2009736 | - | 843 | Protein_1877 | tyrosine-type recombinase/integrase | - |
| OF884_RS09600 | 2009827..2010183 | + | 357 | WP_000003145.1 | hypothetical protein | - |
| OF884_RS09605 | 2010137..2010343 | + | 207 | Protein_1879 | phage tail protein | - |
| OF884_RS09610 | 2010515..2010670 | + | 156 | Protein_1880 | DUF4376 domain-containing protein | - |
| OF884_RS09615 | 2010776..2011108 | + | 333 | WP_031609875.1 | DUF1353 domain-containing protein | - |
| OF884_RS09620 | 2011157..2011266 | + | 110 | Protein_1882 | tail fiber assembly protein | - |
| OF884_RS09625 | 2011357..2011542 | - | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| OF884_RS09630 | 2011785..2011982 | - | 198 | Protein_1884 | tail fiber assembly protein | - |
| OF884_RS09635 | 2011978..2012748 | - | 771 | WP_001652627.1 | transporter substrate-binding domain-containing protein | - |
| OF884_RS09640 | 2012824..2012916 | + | 93 | Protein_1886 | DUF4113 domain-containing protein | - |
| OF884_RS09645 | 2013239..2013367 | + | 129 | Protein_1887 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2002959..2036915 | 33956 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T260404 NZ_CP107010:2008661-2008764 [Salmonella enterica subsp. enterica serovar Paratyphi B]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT260404 NZ_CP107010:c2008766-2008621 [Salmonella enterica subsp. enterica serovar Paratyphi B]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
