Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2054976..2055120 | Replicon | chromosome |
Accession | NZ_CP106890 | ||
Organism | Klebsiella pneumoniae strain KPN_SINK_001 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2055012..2055114 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2054976..2055120 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
N6138_RS10085 (N6138_10085) | 2050106..2052166 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
N6138_RS10090 (N6138_10090) | 2052170..2052829 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
N6138_RS10095 (N6138_10095) | 2052908..2053138 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
N6138_RS10100 (N6138_10100) | 2053251..2053625 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
N6138_RS10105 (N6138_10105) | 2053629..2054498 | + | 870 | WP_020956678.1 | copper homeostasis membrane protein CopD | - |
N6138_RS10110 (N6138_10110) | 2054515..2054853 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2054976..2055120 | - | 145 | - | - | Antitoxin |
- | 2055012..2055114 | + | 103 | - | - | Toxin |
N6138_RS10115 (N6138_10115) | 2055247..2055528 | - | 282 | Protein_1977 | tyrosine-type recombinase/integrase | - |
N6138_RS10120 (N6138_10120) | 2055605..2056084 | + | 480 | WP_032419797.1 | lysis protein | - |
N6138_RS10125 (N6138_10125) | 2056539..2056734 | + | 196 | Protein_1979 | DNA polymerase V | - |
N6138_RS10130 (N6138_10130) | 2056873..2058024 | + | 1152 | WP_099769915.1 | hypothetical protein | - |
N6138_RS10135 (N6138_10135) | 2058050..2059018 | - | 969 | WP_004099053.1 | IS5-like element IS903B family transposase | - |
N6138_RS10140 (N6138_10140) | 2058998..2059444 | + | 447 | WP_139937642.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2036234..2065510 | 29276 | |
- | flank | IS/Tn | - | - | 2058050..2058973 | 923 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T259956 NZ_CP106890:2055012-2055114 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 145 bp
>AT259956 NZ_CP106890:c2055120-2054976 [Klebsiella pneumoniae]
ACATATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
ACATATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT