Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2054964..2055108 | Replicon | chromosome |
Accession | NZ_CP106886 | ||
Organism | Klebsiella pneumoniae strain KPN_PAT_001 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2055000..2055102 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2054964..2055108 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
N6137_RS10090 (N6137_10090) | 2050094..2052154 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
N6137_RS10095 (N6137_10095) | 2052158..2052817 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
N6137_RS10100 (N6137_10100) | 2052896..2053126 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
N6137_RS10105 (N6137_10105) | 2053239..2053613 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
N6137_RS10110 (N6137_10110) | 2053617..2054486 | + | 870 | WP_020956678.1 | copper homeostasis membrane protein CopD | - |
N6137_RS10115 (N6137_10115) | 2054503..2054841 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2054964..2055108 | - | 145 | - | - | Antitoxin |
- | 2055000..2055102 | + | 103 | - | - | Toxin |
N6137_RS10120 (N6137_10120) | 2055235..2055516 | - | 282 | Protein_1978 | tyrosine-type recombinase/integrase | - |
N6137_RS10125 (N6137_10125) | 2055593..2056072 | + | 480 | WP_032419797.1 | lysis protein | - |
N6137_RS10130 (N6137_10130) | 2056527..2056722 | + | 196 | Protein_1980 | DNA polymerase V | - |
N6137_RS10135 (N6137_10135) | 2056861..2058012 | + | 1152 | WP_099769915.1 | hypothetical protein | - |
N6137_RS10140 (N6137_10140) | 2058038..2059006 | - | 969 | WP_004099053.1 | IS5-like element IS903B family transposase | - |
N6137_RS10145 (N6137_10145) | 2058986..2059432 | + | 447 | WP_139937642.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2036224..2065498 | 29274 | |
- | flank | IS/Tn | - | - | 2058038..2058961 | 923 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T259939 NZ_CP106886:2055000-2055102 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 145 bp
>AT259939 NZ_CP106886:c2055108-2054964 [Klebsiella pneumoniae]
ACATATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
ACATATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGT
TGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT