Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2078494..2078626 | Replicon | chromosome |
Accession | NC_016816 | ||
Organism | Pantoea ananatis LMG 5342 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2078529..2078626 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2078494..2078626 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PANA5342_RS32345 | 2073677..2075749 | + | 2073 | WP_015700170.1 | prolyl oligopeptidase family serine peptidase | - |
PANA5342_RS32350 | 2075733..2076404 | - | 672 | WP_015700171.1 | exodeoxyribonuclease X | - |
PANA5342_RS32355 | 2076404..2076634 | - | 231 | WP_019105100.1 | DNA polymerase III subunit theta | - |
PANA5342_RS32360 | 2076785..2077159 | + | 375 | WP_013026061.1 | copper homeostasis periplasmic binding protein CopC | - |
PANA5342_RS32365 | 2077164..2078039 | + | 876 | WP_015700172.1 | copper homeostasis membrane protein CopD | - |
PANA5342_RS32370 | 2078067..2078414 | + | 348 | WP_014593872.1 | YebY family protein | - |
- | 2078494..2078626 | - | 133 | - | - | Antitoxin |
- | 2078529..2078626 | + | 98 | - | - | Toxin |
PANA5342_RS46245 | 2078944..2079132 | - | 189 | WP_141120393.1 | hypothetical protein | - |
PANA5342_RS45680 | 2079178..2079396 | - | 219 | WP_080587427.1 | tyrosine-type recombinase/integrase | - |
PANA5342_RS32380 | 2079835..2080407 | + | 573 | WP_022623257.1 | hypothetical protein | - |
PANA5342_RS32385 | 2080441..2080803 | - | 363 | WP_022623256.1 | phage major tail tube protein | - |
PANA5342_RS32390 | 2080795..2080983 | + | 189 | Protein_1908 | oxidoreductase | - |
PANA5342_RS32395 | 2080983..2082005 | + | 1023 | WP_015700175.1 | phage portal protein | - |
PANA5342_RS46095 | 2082056..2083171 | - | 1116 | WP_015700176.1 | SEC-C domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2075733..2088461 | 12728 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 98 bp
>T25970 NC_016816:2078529-2078626 [Pantoea ananatis LMG 5342]
GCAAGGCGAAAGCCTCTATTAATGCCAACTTTTAGCGCACGGCTCCTTGAGAGCCATTTCCCTAGACCGAATACAGGAAT
CGTGTTCGGTCTTTTTTT
GCAAGGCGAAAGCCTCTATTAATGCCAACTTTTAGCGCACGGCTCCTTGAGAGCCATTTCCCTAGACCGAATACAGGAAT
CGTGTTCGGTCTTTTTTT
Antitoxin
Download Length: 133 bp
>AT25970 NC_016816:c2078626-2078494 [Pantoea ananatis LMG 5342]
AAAAAAAGACCGAACACGATTCCTGTATTCGGTCTAGGGAAATGGCTCTCAAGGAGCCGTGCGCTAAAAGTTGGCATTAA
TAGAGGCTTTCGCCTTGCTTCTAAAGCGTAGGACAACGCGCCAGATTTTCCAG
AAAAAAAGACCGAACACGATTCCTGTATTCGGTCTAGGGAAATGGCTCTCAAGGAGCCGTGCGCTAAAAGTTGGCATTAA
TAGAGGCTTTCGCCTTGCTTCTAAAGCGTAGGACAACGCGCCAGATTTTCCAG