Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3860573..3860718 | Replicon | chromosome |
Accession | NZ_CP104858 | ||
Organism | Salmonella sp. 3C |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3860613..3860716 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3860573..3860718 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
N7E69_RS18480 | 3856999..3857697 | - | 699 | WP_000944287.1 | exodeoxyribonuclease X | - |
N7E69_RS18485 | 3857721..3858377 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
N7E69_RS18490 | 3858485..3858715 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
N7E69_RS18495 | 3858853..3859227 | + | 375 | WP_000168392.1 | CopC domain-containing protein YobA | - |
N7E69_RS18500 | 3859228..3860103 | + | 876 | WP_000979703.1 | copper homeostasis membrane protein CopD | - |
N7E69_RS18505 | 3860120..3860473 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 3860573..3860718 | - | 146 | - | - | Antitoxin |
- | 3860613..3860716 | + | 104 | - | - | Toxin |
N7E69_RS18510 | 3860856..3861935 | - | 1080 | WP_000087638.1 | phage integrase Arm DNA-binding domain-containing protein | - |
N7E69_RS18515 | 3861910..3862188 | - | 279 | WP_001675651.1 | excisionase | - |
N7E69_RS18520 | 3862249..3862677 | - | 429 | WP_000743301.1 | hypothetical protein | - |
N7E69_RS18525 | 3862776..3862961 | - | 186 | WP_000280163.1 | DUF1187 family protein | - |
N7E69_RS18530 | 3863008..3863838 | - | 831 | WP_001126030.1 | recombination protein RecT | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sodCI / sopE2 / sopE2 | 3854911..3941603 | 86692 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T259376 NZ_CP104858:3860613-3860716 [Salmonella sp. 3C]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT259376 NZ_CP104858:c3860718-3860573 [Salmonella sp. 3C]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG