Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1591843..1591956 | Replicon | chromosome |
Accession | NZ_CP104758 | ||
Organism | Kalamiella piersonii strain GABEKP28 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1591856..1591956 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1591843..1591956 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
N5580_RS07425 (1586985) | 1586985..1589048 | + | 2064 | WP_269950168.1 | prolyl oligopeptidase family serine peptidase | - |
N5580_RS07430 (1589042) | 1589042..1589710 | - | 669 | WP_269950169.1 | exodeoxyribonuclease X | - |
N5580_RS07435 (1589714) | 1589714..1589944 | - | 231 | WP_120453863.1 | DNA polymerase III subunit theta | - |
N5580_RS07440 (1590096) | 1590096..1590461 | + | 366 | WP_269950170.1 | copper homeostasis periplasmic binding protein CopC | - |
N5580_RS07445 (1590465) | 1590465..1591340 | + | 876 | WP_269950171.1 | copper homeostasis membrane protein CopD | - |
N5580_RS07450 (1591376) | 1591376..1591723 | + | 348 | WP_269950324.1 | YebY family protein | - |
- (1591843) | 1591843..1591956 | - | 114 | NuclAT_0 | - | Antitoxin |
- (1591856) | 1591856..1591956 | + | 101 | NuclT_0 | - | Toxin |
N5580_RS07455 (1592507) | 1592507..1592683 | + | 177 | WP_120453869.1 | general stress protein | - |
N5580_RS07460 (1592886) | 1592886..1593257 | + | 372 | WP_120453871.1 | anti-adapter protein IraP | - |
N5580_RS07465 (1593326) | 1593326..1593652 | - | 327 | WP_120453873.1 | four-helix bundle copper-binding protein | - |
N5580_RS07470 (1593998) | 1593998..1594855 | + | 858 | WP_120453875.1 | manganese catalase family protein | - |
N5580_RS07475 (1595178) | 1595178..1595384 | - | 207 | WP_120453877.1 | hypothetical protein | - |
N5580_RS07480 (1595779) | 1595779..1596438 | + | 660 | WP_120453879.1 | metallophosphoesterase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 101 bp
>T259122 NZ_CP104758:1591856-1591956 [Kalamiella piersonii]
GGCAAGGCGAAATCGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTACAAGAGCCATTTCCCTGGACCGAATACAGG
AATCGTGTTCGGTCTTTTTTT
GGCAAGGCGAAATCGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTACAAGAGCCATTTCCCTGGACCGAATACAGG
AATCGTGTTCGGTCTTTTTTT
Antitoxin
Download Length: 114 bp
>AT259122 NZ_CP104758:c1591956-1591843 [Kalamiella piersonii]
AAAAAAAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGTAGAGCCGTGCGCTAAAAGTTGGCATTAA
TGCAGGCGATTTCGCCTTGCCAGTTAAGATTAGA
AAAAAAAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGTAGAGCCGTGCGCTAAAAGTTGGCATTAA
TGCAGGCGATTTCGCCTTGCCAGTTAAGATTAGA