Detailed information of TA system
Overview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2110639..2110910 | Replicon | chromosome |
Accession | NZ_CP104721 | ||
Organism | Escherichia coli strain ECO3183 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2110769..2110872 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2110639..2110910 (-) |
Genomic Context
Location: 2109007..2109381 (375 bp)
Type: Others
Protein ID: WP_000168747.1
Type: Others
Protein ID: WP_000168747.1
Location: 2109385..2110257 (873 bp)
Type: Others
Protein ID: WP_000879289.1
Type: Others
Protein ID: WP_000879289.1
Location: 2110270..2110611 (342 bp)
Type: Others
Protein ID: WP_000976476.1
Type: Others
Protein ID: WP_000976476.1
Location: 2110769..2110872 (104 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 2111007..2111663 (657 bp)
Type: Others
Protein ID: WP_000812724.1
Type: Others
Protein ID: WP_000812724.1
Location: 2107194..2107856 (663 bp)
Type: Others
Protein ID: WP_000944256.1
Type: Others
Protein ID: WP_000944256.1
Location: 2107880..2108536 (657 bp)
Type: Others
Protein ID: WP_000011658.1
Type: Others
Protein ID: WP_000011658.1
Location: 2108638..2108868 (231 bp)
Type: Others
Protein ID: WP_000916763.1
Type: Others
Protein ID: WP_000916763.1
Location: 2110639..2110910 (272 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 2111664..2111855 (192 bp)
Type: Others
Protein ID: WP_000457842.1
Type: Others
Protein ID: WP_000457842.1
Location: 2111960..2112196 (237 bp)
Type: Others
Protein ID: WP_001295499.1
Type: Others
Protein ID: WP_001295499.1
Location: 2112314..2113753 (1440 bp)
Type: Others
Protein ID: WP_001352260.1
Type: Others
Protein ID: WP_001352260.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
N5O92_RS10125 | 2107194..2107856 | - | 663 | WP_000944256.1 | exodeoxyribonuclease X | - |
N5O92_RS10130 | 2107880..2108536 | - | 657 | WP_000011658.1 | carbon-nitrogen hydrolase family protein YobB | - |
N5O92_RS10135 | 2108638..2108868 | - | 231 | WP_000916763.1 | DNA polymerase III subunit theta | - |
N5O92_RS10140 | 2109007..2109381 | + | 375 | WP_000168747.1 | CopC domain-containing protein YobA | - |
N5O92_RS10145 | 2109385..2110257 | + | 873 | WP_000879289.1 | copper homeostasis membrane protein CopD | - |
N5O92_RS10150 | 2110270..2110611 | + | 342 | WP_000976476.1 | YebY family protein | - |
- | 2110639..2110910 | - | 272 | - | - | Antitoxin |
- | 2110769..2110872 | + | 104 | - | - | Toxin |
N5O92_RS10155 | 2111007..2111663 | + | 657 | WP_000812724.1 | protein-serine/threonine phosphatase | - |
N5O92_RS10160 | 2111664..2111855 | - | 192 | WP_000457842.1 | YebW family protein | - |
N5O92_RS10165 | 2111960..2112196 | - | 237 | WP_001295499.1 | YebV family protein | - |
N5O92_RS10170 | 2112314..2113753 | - | 1440 | WP_001352260.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
No matching records found |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T259042 NZ_CP104721:2110769-2110872 [Escherichia coli]
GGCAAGGCAACTAAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTGTTCGGTCTCTTTTT
GGCAAGGCAACTAAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTGTTCGGTCTCTTTTT
Antitoxin
Download Length: 272 bp
>AT259042 NZ_CP104721:c2110910-2110639 [Escherichia coli]
AAAGTCAGCGAAGGAAATGCTTCTGGCTTTTAACAGATAAAAAGAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAA
TGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCATTAATGCAGGCTTAGTTGCCTTGCCCTTTAAGAATAGATGACG
ACGCCAGGTTTTCCAGTTTGCGTGCAAAATGGTCAATAAAAAGCGTGGTGGTCATCAGCTGAAATGTTAAAAACCGCCCG
TTCTGGTGAAAGAACTGAGGCGGTTTTTTTAT
AAAGTCAGCGAAGGAAATGCTTCTGGCTTTTAACAGATAAAAAGAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAA
TGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCATTAATGCAGGCTTAGTTGCCTTGCCCTTTAAGAATAGATGACG
ACGCCAGGTTTTCCAGTTTGCGTGCAAAATGGTCAATAAAAAGCGTGGTGGTCATCAGCTGAAATGTTAAAAACCGCCCG
TTCTGGTGAAAGAACTGAGGCGGTTTTTTTAT