Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3039018..3039163 | Replicon | chromosome |
Accession | NZ_CP104643 | ||
Organism | Salmonella enterica strain 1020677 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3039020..3039123 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3039018..3039163 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
N5930_RS14860 | 3034218..3034436 | - | 219 | WP_001524708.1 | hypothetical protein | - |
N5930_RS14865 | 3034738..3034836 | - | 99 | WP_223151200.1 | hypothetical protein | - |
N5930_RS14870 | 3035155..3037134 | - | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
N5930_RS14875 | 3037548..3037826 | + | 279 | WP_001575998.1 | excisionase | - |
N5930_RS14880 | 3037801..3038880 | + | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 3039018..3039163 | + | 146 | - | - | Antitoxin |
- | 3039020..3039123 | - | 104 | - | - | Toxin |
N5930_RS14885 | 3039263..3039616 | - | 354 | WP_000722370.1 | YebY family protein | - |
N5930_RS14890 | 3039633..3040508 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
N5930_RS14895 | 3040509..3040883 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
N5930_RS14900 | 3041021..3041251 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
N5930_RS14905 | 3041359..3042015 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
N5930_RS14910 | 3042039..3042737 | + | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 / sopE2 / sodCI | 2985119..3044825 | 59706 | |
- | inside | Prophage | - | sopE2 / sopE2 / sodCI | 2985119..3046502 | 61383 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T258768 NZ_CP104643:c3039123-3039020 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT258768 NZ_CP104643:3039018-3039163 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG