Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2687071..2687216 | Replicon | chromosome |
Accession | NZ_CP104641 | ||
Organism | Salmonella enterica strain 1019942 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2687073..2687176 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2687071..2687216 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
N5927_RS13175 | 2682271..2682489 | - | 219 | WP_001524708.1 | hypothetical protein | - |
N5927_RS13180 | 2682791..2682889 | - | 99 | WP_223151200.1 | hypothetical protein | - |
N5927_RS13185 | 2683208..2685187 | - | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
N5927_RS13190 | 2685601..2685879 | + | 279 | WP_001575998.1 | excisionase | - |
N5927_RS13195 | 2685854..2686933 | + | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2687071..2687216 | + | 146 | - | - | Antitoxin |
- | 2687073..2687176 | - | 104 | - | - | Toxin |
N5927_RS13200 | 2687316..2687669 | - | 354 | WP_000722370.1 | YebY family protein | - |
N5927_RS13205 | 2687686..2688561 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
N5927_RS13210 | 2688562..2688936 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
N5927_RS13215 | 2689074..2689304 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
N5927_RS13220 | 2689412..2690068 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
N5927_RS13225 | 2690092..2690790 | + | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 / sodCI | 2651043..2692878 | 41835 | |
- | inside | Prophage | - | sopE2 / sodCI | 2661079..2690790 | 29711 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T258745 NZ_CP104641:c2687176-2687073 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT258745 NZ_CP104641:2687071-2687216 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG