Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 830587..830732 | Replicon | chromosome |
| Accession | NZ_CP104638 | ||
| Organism | Salmonella enterica strain PNUSAS118466 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 830627..830730 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 830587..830732 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| N4311_RS04930 | 827013..827711 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| N4311_RS04935 | 827735..828391 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| N4311_RS04940 | 828499..828729 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| N4311_RS04945 | 828867..829241 | + | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
| N4311_RS04950 | 829242..830117 | + | 876 | WP_000979684.1 | copper homeostasis membrane protein CopD | - |
| N4311_RS04955 | 830134..830487 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 830587..830732 | - | 146 | - | - | Antitoxin |
| - | 830627..830730 | + | 104 | - | - | Toxin |
| N4311_RS04960 | 830860..831939 | - | 1080 | WP_000087646.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| N4311_RS04965 | 831969..832964 | - | 996 | Protein_788 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| N4311_RS04970 | 833112..833360 | + | 249 | Protein_789 | glycoside hydrolase family 19 protein | - |
| N4311_RS04975 | 833357..833891 | + | 535 | Protein_790 | DUF2514 domain-containing protein | - |
| N4311_RS04980 | 834148..834315 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| N4311_RS04985 | 834380..834568 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| N4311_RS04990 | 834623..834883 | + | 261 | Protein_793 | DUF1441 family protein | - |
| N4311_RS04995 | 835098..835442 | + | 345 | Protein_794 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 824925..870488 | 45563 | |
| - | inside | Prophage | - | sopE2 | 827013..855347 | 28334 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T258695 NZ_CP104638:830627-830730 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT258695 NZ_CP104638:c830732-830587 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
