Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2764211..2764354 | Replicon | chromosome |
Accession | NZ_CP104491 | ||
Organism | Salmonella enterica strain SalSpp_sample_05_No.1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2764213..2764316 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2764211..2764354 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
N4229_RS13600 | 2759816..2760085 | + | 270 | WP_077942236.1 | hypothetical protein | - |
N4229_RS13605 | 2760251..2760391 | + | 141 | WP_045899713.1 | hypothetical protein | - |
N4229_RS13610 | 2760534..2761079 | - | 546 | Protein_2669 | transposase | - |
N4229_RS13615 | 2761221..2763458 | - | 2238 | WP_088766517.1 | NEL-type E3 ubiquitin ligase domain-containing protein | - |
N4229_RS13620 | 2763631..2763714 | - | 84 | Protein_2671 | phage tail protein | - |
N4229_RS13625 | 2763726..2764073 | + | 348 | Protein_2672 | tyrosine-type recombinase/integrase | - |
- | 2764211..2764354 | + | 144 | - | - | Antitoxin |
- | 2764213..2764316 | - | 104 | - | - | Toxin |
N4229_RS13630 | 2764456..2764809 | - | 354 | WP_000722368.1 | YebY family protein | - |
N4229_RS13635 | 2764826..2765701 | - | 876 | WP_000979705.1 | copper homeostasis membrane protein CopD | - |
N4229_RS13640 | 2765702..2766076 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
N4229_RS13645 | 2766214..2766444 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
N4229_RS13650 | 2766552..2767208 | + | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
N4229_RS13655 | 2767232..2767930 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 2760534..2761214 | 680 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T258116 NZ_CP104491:c2764316-2764213 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT258116 NZ_CP104491:2764211-2764354 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG