Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2061889..2062035 | Replicon | chromosome |
| Accession | NZ_CP104482 | ||
| Organism | Salmonella enterica strain SalSpp_sample_08_No.4 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2061927..2062030 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2061889..2062035 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| N4230_RS10060 | 2058314..2059012 | - | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
| N4230_RS10065 | 2059036..2059692 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| N4230_RS10070 | 2059800..2060030 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| N4230_RS10075 | 2060168..2060542 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| N4230_RS10080 | 2060543..2061418 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| N4230_RS10085 | 2061435..2061788 | + | 354 | WP_000722370.1 | YebY family protein | - |
| - | 2061889..2062035 | - | 147 | - | - | Antitoxin |
| - | 2061927..2062030 | + | 104 | - | - | Toxin |
| N4230_RS10090 | 2062151..2063073 | - | 923 | Protein_1971 | tyrosine-type recombinase/integrase | - |
| N4230_RS10095 | 2063337..2063798 | - | 462 | Protein_1972 | DNA breaking-rejoining protein | - |
| N4230_RS10100 | 2063787..2063978 | + | 192 | Protein_1973 | glycoside hydrolase family 19 protein | - |
| N4230_RS10105 | 2064032..2064565 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| N4230_RS10110 | 2064822..2064989 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| N4230_RS10115 | 2065296..2065556 | + | 261 | Protein_1976 | DUF1441 family protein | - |
| N4230_RS10120 | 2065558..2065773 | + | 216 | Protein_1977 | shikimate transporter | - |
| N4230_RS10125 | 2065783..2066070 | + | 288 | Protein_1978 | macro domain-containing protein | - |
| N4230_RS10130 | 2066083..2066594 | + | 512 | Protein_1979 | tail fiber assembly protein | - |
| N4230_RS10135 | 2066691..2066891 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1991324..2092233 | 100909 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T258062 NZ_CP104482:2061927-2062030 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 147 bp
>AT258062 NZ_CP104482:c2062035-2061889 [Salmonella enterica]
CAAATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
CAAATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTT
GGCATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
