Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2783937..2784080 | Replicon | chromosome |
| Accession | NZ_CP103791 | ||
| Organism | Salmonella enterica subsp. enterica serovar Infantis strain MRS17_00712 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2783939..2784042 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2783937..2784080 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NYQ90_RS13470 | 2779067..2779267 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
| NYQ90_RS13475 | 2779364..2779875 | - | 512 | Protein_2631 | tail fiber assembly protein | - |
| NYQ90_RS13480 | 2779888..2780175 | - | 288 | Protein_2632 | macro domain-containing protein | - |
| NYQ90_RS13485 | 2780185..2780400 | - | 216 | Protein_2633 | shikimate transporter | - |
| NYQ90_RS13490 | 2780402..2780662 | - | 261 | Protein_2634 | DUF1441 family protein | - |
| NYQ90_RS13495 | 2780970..2781137 | + | 168 | WP_000789529.1 | lytic enzyme | - |
| NYQ90_RS13500 | 2781394..2781927 | - | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| NYQ90_RS13505 | 2781981..2782172 | - | 192 | Protein_2637 | glycoside hydrolase family 19 protein | - |
| NYQ90_RS13510 | 2782161..2782622 | + | 462 | Protein_2638 | DNA breaking-rejoining protein | - |
| NYQ90_RS13515 | 2782886..2783779 | + | 894 | Protein_2639 | tyrosine-type recombinase/integrase | - |
| - | 2783937..2784080 | + | 144 | - | - | Antitoxin |
| - | 2783939..2784042 | - | 104 | - | - | Toxin |
| NYQ90_RS13520 | 2784182..2784535 | - | 354 | WP_000722368.1 | YebY family protein | - |
| NYQ90_RS13525 | 2784552..2785427 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| NYQ90_RS13530 | 2785428..2785802 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NYQ90_RS13535 | 2785940..2786170 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NYQ90_RS13540 | 2786278..2786934 | + | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| NYQ90_RS13545 | 2786958..2787656 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2764357..2805951 | 41594 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T256674 NZ_CP103791:c2784042-2783939 [Salmonella enterica subsp. enterica serovar Infantis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT256674 NZ_CP103791:2783937-2784080 [Salmonella enterica subsp. enterica serovar Infantis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
