Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1943888..1944033 | Replicon | chromosome |
Accession | NZ_CP103586 | ||
Organism | Klebsiella pneumoniae strain 4737 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1943924..1944026 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1943888..1944033 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
M5T07_RS09520 | 1939018..1941078 | + | 2061 | WP_004148850.1 | oligopeptidase B | - |
M5T07_RS09525 | 1941082..1941741 | - | 660 | WP_032435029.1 | exodeoxyribonuclease X | - |
M5T07_RS09530 | 1941820..1942050 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
M5T07_RS09535 | 1942163..1942537 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
M5T07_RS09540 | 1942541..1943410 | + | 870 | WP_032435031.1 | copper homeostasis membrane protein CopD | - |
M5T07_RS09545 | 1943427..1943765 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1943888..1944033 | - | 146 | - | - | Antitoxin |
- | 1943924..1944026 | + | 103 | - | - | Toxin |
M5T07_RS09550 | 1944401..1944544 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
M5T07_RS09555 | 1944649..1945617 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
M5T07_RS09560 | 1945774..1946427 | + | 654 | WP_004891053.1 | protein-serine/threonine phosphatase | - |
M5T07_RS09565 | 1946424..1946615 | - | 192 | WP_002911395.1 | YebW family protein | - |
M5T07_RS09570 | 1946713..1946952 | - | 240 | WP_002911393.1 | YebV family protein | - |
M5T07_RS09575 | 1947068..1948501 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1873861..1948456 | 74595 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T255680 NZ_CP103586:1943924-1944026 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT255680 NZ_CP103586:c1944033-1943888 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT