Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1878847..1878994 | Replicon | chromosome |
Accession | NZ_CP103487 | ||
Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain 5463 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1878888..1878990 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1878847..1878994 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
M5T26_RS09085 | 1873982..1876042 | + | 2061 | WP_048297811.1 | oligopeptidase B | - |
M5T26_RS09090 | 1876046..1876705 | - | 660 | WP_023290237.1 | exodeoxyribonuclease X | - |
M5T26_RS09095 | 1876784..1877014 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
M5T26_RS09100 | 1877127..1877501 | + | 375 | WP_032453372.1 | CopC domain-containing protein YobA | - |
M5T26_RS09105 | 1877505..1878374 | + | 870 | WP_177335450.1 | copper homeostasis membrane protein CopD | - |
M5T26_RS09110 | 1878391..1878729 | + | 339 | WP_072413393.1 | YebY family protein | - |
- | 1878847..1878994 | - | 148 | - | - | Antitoxin |
- | 1878888..1878990 | + | 103 | - | - | Toxin |
M5T26_RS09115 | 1879369..1879512 | - | 144 | WP_032425946.1 | Ecr family regulatory small membrane protein | - |
M5T26_RS09120 | 1879613..1880581 | - | 969 | WP_072413392.1 | VirK/YbjX family protein | - |
M5T26_RS09125 | 1880738..1881391 | + | 654 | WP_023290232.1 | protein-serine/threonine phosphatase | - |
M5T26_RS09130 | 1881388..1881579 | - | 192 | WP_002911395.1 | YebW family protein | - |
M5T26_RS09135 | 1881677..1881916 | - | 240 | WP_002911393.1 | YebV family protein | - |
M5T26_RS09140 | 1882032..1883462 | - | 1431 | WP_087824136.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T255157 NZ_CP103487:1878888-1878990 [Klebsiella quasipneumoniae subsp. quasipneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 148 bp
>AT255157 NZ_CP103487:c1878994-1878847 [Klebsiella quasipneumoniae subsp. quasipneumoniae]
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGTCTGCG