Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2225825..2226096 | Replicon | chromosome |
Accession | NZ_CP103468 | ||
Organism | Escherichia coli strain 4973 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2225955..2226058 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2225825..2226096 (-) |
Genomic Context
Location: 2224193..2224567 (375 bp)
Type: Others
Protein ID: WP_022645803.1
Type: Others
Protein ID: WP_022645803.1
Location: 2224571..2225443 (873 bp)
Type: Others
Protein ID: WP_022645802.1
Type: Others
Protein ID: WP_022645802.1
Location: 2225456..2225797 (342 bp)
Type: Others
Protein ID: WP_000976472.1
Type: Others
Protein ID: WP_000976472.1
Location: 2225955..2226058 (104 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 2226193..2226849 (657 bp)
Type: Others
Protein ID: WP_022645801.1
Type: Others
Protein ID: WP_022645801.1
Location: 2222380..2223042 (663 bp)
Type: Others
Protein ID: WP_000944256.1
Type: Others
Protein ID: WP_000944256.1
Location: 2223066..2223722 (657 bp)
Type: Others
Protein ID: WP_000011651.1
Type: Others
Protein ID: WP_000011651.1
Location: 2223824..2224054 (231 bp)
Type: Others
Protein ID: WP_000916763.1
Type: Others
Protein ID: WP_000916763.1
Location: 2225825..2226096 (272 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 2226850..2227041 (192 bp)
Type: Others
Protein ID: WP_001296140.1
Type: Others
Protein ID: WP_001296140.1
Location: 2227146..2227382 (237 bp)
Type: Others
Protein ID: WP_001295499.1
Type: Others
Protein ID: WP_001295499.1
Location: 2227500..2228939 (1440 bp)
Type: Others
Protein ID: WP_024181822.1
Type: Others
Protein ID: WP_024181822.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
M5S50_RS10480 | 2222380..2223042 | - | 663 | WP_000944256.1 | exodeoxyribonuclease X | - |
M5S50_RS10485 | 2223066..2223722 | - | 657 | WP_000011651.1 | carbon-nitrogen hydrolase family protein YobB | - |
M5S50_RS10490 | 2223824..2224054 | - | 231 | WP_000916763.1 | DNA polymerase III subunit theta | - |
M5S50_RS10495 | 2224193..2224567 | + | 375 | WP_022645803.1 | CopC domain-containing protein YobA | - |
M5S50_RS10500 | 2224571..2225443 | + | 873 | WP_022645802.1 | copper homeostasis membrane protein CopD | - |
M5S50_RS10505 | 2225456..2225797 | + | 342 | WP_000976472.1 | YebY family protein | - |
- | 2225825..2226096 | - | 272 | - | - | Antitoxin |
- | 2225955..2226058 | + | 104 | - | - | Toxin |
M5S50_RS10510 | 2226193..2226849 | + | 657 | WP_022645801.1 | protein-serine/threonine phosphatase | - |
M5S50_RS10515 | 2226850..2227041 | - | 192 | WP_001296140.1 | YebW family protein | - |
M5S50_RS10520 | 2227146..2227382 | - | 237 | WP_001295499.1 | YebV family protein | - |
M5S50_RS10525 | 2227500..2228939 | - | 1440 | WP_024181822.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
No matching records found |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T255102 NZ_CP103468:2225955-2226058 [Escherichia coli]
GGCAAGGCAACTAAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTGTTCGGTCTCTTTTT
GGCAAGGCAACTAAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTGTTCGGTCTCTTTTT
Antitoxin
Download Length: 272 bp
>AT255102 NZ_CP103468:c2226096-2225825 [Escherichia coli]
AAAGTCAGCGAAGGGAATGCTTCTGGCTTTTAACAGATAAAAAGAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAA
TGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCATTAATGCAGGCTTAGTTGCCTTGCCCTTTAAGAATAGATGACG
ACGCCAGGTTTTCCAGTTTGCGTGCAAAATGGTCAATAAAAAGCGCGGTGGTCATCAGCTTAAATGTTAAAAACCGCCCG
TTCTGGTGAAAGAACTGAGGCGGTTTTTTTAT
AAAGTCAGCGAAGGGAATGCTTCTGGCTTTTAACAGATAAAAAGAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAA
TGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCATTAATGCAGGCTTAGTTGCCTTGCCCTTTAAGAATAGATGACG
ACGCCAGGTTTTCCAGTTTGCGTGCAAAATGGTCAATAAAAAGCGCGGTGGTCATCAGCTTAAATGTTAAAAACCGCCCG
TTCTGGTGAAAGAACTGAGGCGGTTTTTTTAT