Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2713863..2714008 | Replicon | chromosome |
| Accession | NZ_CP102827 | ||
| Organism | Salmonella enterica subsp. enterica serovar Indiana strain XZ14C1328 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2713865..2713968 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2713863..2714008 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NV345_RS13130 | 2709596..2709724 | - | 129 | Protein_2550 | helix-turn-helix domain-containing protein | - |
| NV345_RS13135 | 2710047..2710151 | - | 105 | Protein_2551 | DUF4113 domain-containing protein | - |
| NV345_RS13140 | 2710214..2710984 | + | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| NV345_RS13145 | 2710980..2711168 | + | 189 | Protein_2553 | tail fiber assembly protein | - |
| NV345_RS13150 | 2711420..2711605 | + | 186 | WP_071787785.1 | PagK family vesicle-borne virulence factor | - |
| NV345_RS13155 | 2711696..2711805 | - | 110 | Protein_2555 | tail fiber assembly protein | - |
| NV345_RS13160 | 2711854..2712185 | - | 332 | Protein_2556 | DUF1353 domain-containing protein | - |
| NV345_RS13165 | 2712291..2712824 | - | 534 | Protein_2557 | DUF4376 domain-containing protein | - |
| NV345_RS13170 | 2713094..2713744 | + | 651 | Protein_2558 | tyrosine-type recombinase/integrase | - |
| - | 2713863..2714008 | + | 146 | - | - | Antitoxin |
| - | 2713865..2713968 | - | 104 | - | - | Toxin |
| NV345_RS13175 | 2714108..2714461 | - | 354 | WP_000722368.1 | YebY family protein | - |
| NV345_RS13180 | 2714478..2715353 | - | 876 | WP_001579467.1 | copper homeostasis membrane protein CopD | - |
| NV345_RS13185 | 2715354..2715728 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NV345_RS13190 | 2715866..2716096 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NV345_RS13195 | 2716204..2716860 | + | 657 | WP_023227121.1 | carbon-nitrogen hydrolase family protein | - |
| NV345_RS13200 | 2716884..2717582 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 2711754..2735874 | 24120 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T254208 NZ_CP102827:c2713968-2713865 [Salmonella enterica subsp. enterica serovar Indiana]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT254208 NZ_CP102827:2713863-2714008 [Salmonella enterica subsp. enterica serovar Indiana]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
