Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2871227..2871370 | Replicon | chromosome |
| Accession | NZ_CP102756 | ||
| Organism | Salmonella enterica subsp. enterica serovar Kentucky isolate AH19MCS11 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2871229..2871332 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2871227..2871370 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NWA04_RS13930 | 2866292..2866384 | - | 93 | WP_230855586.1 | hypothetical protein | - |
| NWA04_RS13935 | 2866414..2866758 | - | 345 | Protein_2711 | E3 ubiquitin--protein ligase | - |
| NWA04_RS13940 | 2866826..2867623 | - | 798 | WP_000544828.1 | IS21-like element IS21 family helper ATPase IstB | - |
| NWA04_RS13945 | 2867623..2868795 | - | 1173 | WP_000952349.1 | IS21-like element IS21 family transposase | - |
| NWA04_RS13950 | 2868878..2870482 | - | 1605 | Protein_2714 | E3 ubiquitin--protein ligase | - |
| NWA04_RS13955 | 2870656..2870739 | - | 84 | Protein_2715 | phage tail protein | - |
| NWA04_RS13960 | 2870751..2871098 | + | 348 | Protein_2716 | tyrosine-type recombinase/integrase | - |
| - | 2871227..2871370 | + | 144 | - | - | Antitoxin |
| - | 2871229..2871332 | - | 104 | - | - | Toxin |
| NWA04_RS13965 | 2871472..2871825 | - | 354 | WP_000722368.1 | YebY family protein | - |
| NWA04_RS13970 | 2871842..2872717 | - | 876 | WP_023223935.1 | copper homeostasis membrane protein CopD | - |
| NWA04_RS13975 | 2872718..2873092 | - | 375 | WP_023205606.1 | CopC domain-containing protein YobA | - |
| NWA04_RS13980 | 2873230..2873460 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NWA04_RS13985 | 2873568..2874224 | + | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| NWA04_RS13990 | 2874248..2874946 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 / sspH2 / sspH1 | 2847572..2877032 | 29460 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T254149 NZ_CP102756:c2871332-2871229 [Salmonella enterica subsp. enterica serovar Kentucky]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT254149 NZ_CP102756:2871227-2871370 [Salmonella enterica subsp. enterica serovar Kentucky]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
