Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2848295..2848438 | Replicon | chromosome |
| Accession | NZ_CP102739 | ||
| Organism | Salmonella enterica subsp. enterica serovar Kentucky strain AH19MCS8 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2848297..2848400 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2848295..2848438 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NWA03_RS13795 | 2843360..2843452 | - | 93 | WP_230855586.1 | hypothetical protein | - |
| NWA03_RS13800 | 2843482..2843826 | - | 345 | Protein_2682 | E3 ubiquitin--protein ligase | - |
| NWA03_RS13805 | 2843894..2844691 | - | 798 | WP_000544828.1 | IS21-like element IS21 family helper ATPase IstB | - |
| NWA03_RS13810 | 2844691..2845863 | - | 1173 | WP_000952349.1 | IS21-like element IS21 family transposase | - |
| NWA03_RS13815 | 2845946..2847550 | - | 1605 | Protein_2685 | E3 ubiquitin--protein ligase | - |
| NWA03_RS13820 | 2847724..2847807 | - | 84 | Protein_2686 | phage tail protein | - |
| NWA03_RS13825 | 2847819..2848166 | + | 348 | Protein_2687 | tyrosine-type recombinase/integrase | - |
| - | 2848295..2848438 | + | 144 | - | - | Antitoxin |
| - | 2848297..2848400 | - | 104 | - | - | Toxin |
| NWA03_RS13830 | 2848540..2848893 | - | 354 | WP_000722368.1 | YebY family protein | - |
| NWA03_RS13835 | 2848910..2849785 | - | 876 | WP_023223935.1 | copper homeostasis membrane protein CopD | - |
| NWA03_RS13840 | 2849786..2850160 | - | 375 | WP_023205606.1 | CopC domain-containing protein YobA | - |
| NWA03_RS13845 | 2850298..2850528 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NWA03_RS13850 | 2850636..2851292 | + | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| NWA03_RS13855 | 2851316..2852014 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sspH2 / sspH1 | 2832011..2854100 | 22089 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T254094 NZ_CP102739:c2848400-2848297 [Salmonella enterica subsp. enterica serovar Kentucky]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT254094 NZ_CP102739:2848295-2848438 [Salmonella enterica subsp. enterica serovar Kentucky]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
