Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2870108..2870251 | Replicon | chromosome |
| Accession | NZ_CP102719 | ||
| Organism | Salmonella enterica subsp. enterica serovar Kentucky isolate AH19MCS1 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2870110..2870213 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2870108..2870251 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NWA05_RS13885 | 2865251..2865670 | - | 420 | WP_023205587.1 | GNAT family N-acetyltransferase | - |
| NWA05_RS13890 | 2865799..2865999 | - | 201 | WP_023223931.1 | hypothetical protein | - |
| NWA05_RS13895 | 2866039..2866307 | + | 269 | Protein_2703 | hypothetical protein | - |
| NWA05_RS13900 | 2866473..2866613 | + | 141 | WP_031607419.1 | hypothetical protein | - |
| NWA05_RS13905 | 2866759..2867287 | - | 529 | Protein_2705 | transposase | - |
| NWA05_RS13910 | 2867307..2867399 | - | 93 | WP_230855586.1 | hypothetical protein | - |
| NWA05_RS13915 | 2867429..2869363 | - | 1935 | WP_024147907.1 | NEL-type E3 ubiquitin ligase domain-containing protein | - |
| NWA05_RS13920 | 2869537..2869620 | - | 84 | Protein_2708 | phage tail protein | - |
| NWA05_RS13925 | 2869632..2869979 | + | 348 | Protein_2709 | tyrosine-type recombinase/integrase | - |
| - | 2870108..2870251 | + | 144 | - | - | Antitoxin |
| - | 2870110..2870213 | - | 104 | - | - | Toxin |
| NWA05_RS13930 | 2870353..2870706 | - | 354 | WP_000722368.1 | YebY family protein | - |
| NWA05_RS13935 | 2870723..2871598 | - | 876 | WP_023223935.1 | copper homeostasis membrane protein CopD | - |
| NWA05_RS13940 | 2871599..2871973 | - | 375 | WP_023205606.1 | CopC domain-containing protein YobA | - |
| NWA05_RS13945 | 2872111..2872341 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NWA05_RS13950 | 2872449..2873105 | + | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| NWA05_RS13955 | 2873129..2873827 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T254077 NZ_CP102719:c2870213-2870110 [Salmonella enterica subsp. enterica serovar Kentucky]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT254077 NZ_CP102719:2870108-2870251 [Salmonella enterica subsp. enterica serovar Kentucky]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
