Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 335355..335498 | Replicon | chromosome |
Accession | NZ_CP101689 | ||
Organism | Salmonella enterica subsp. enterica serovar Mbandaka strain SMEH |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 335357..335460 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 335355..335498 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NOV91_RS01605 | 330809..331078 | + | 270 | WP_077907250.1 | hypothetical protein | - |
NOV91_RS01610 | 331244..331384 | + | 141 | WP_031615664.1 | hypothetical protein | - |
NOV91_RS01615 | 331530..332058 | - | 529 | Protein_318 | transposase | - |
NOV91_RS01620 | 332078..332170 | - | 93 | WP_230855586.1 | hypothetical protein | - |
NOV91_RS01625 | 332200..334620 | - | 2421 | WP_024149295.1 | type III secretion system effector SspH3 | - |
NOV91_RS01630 | 334794..334877 | - | 84 | Protein_321 | phage tail protein | - |
NOV91_RS01635 | 334889..335236 | + | 348 | Protein_322 | tyrosine-type recombinase/integrase | - |
- | 335355..335498 | + | 144 | - | - | Antitoxin |
- | 335357..335460 | - | 104 | - | - | Toxin |
NOV91_RS01640 | 335601..335954 | - | 354 | WP_017441954.1 | YebY family protein | - |
NOV91_RS01645 | 335971..336846 | - | 876 | WP_017441953.1 | copper homeostasis membrane protein CopD | - |
NOV91_RS01650 | 336847..337221 | - | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
NOV91_RS01655 | 337359..337589 | + | 231 | WP_017441952.1 | DNA polymerase III subunit theta | - |
NOV91_RS01660 | 337697..338353 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
NOV91_RS01665 | 338377..339075 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 331530..331868 | 338 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T252485 NZ_CP101689:c335460-335357 [Salmonella enterica subsp. enterica serovar Mbandaka]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT252485 NZ_CP101689:335355-335498 [Salmonella enterica subsp. enterica serovar Mbandaka]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAAGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAAGTTTTCCAGTTTG