Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2422431..2422574 | Replicon | chromosome |
| Accession | NZ_CP101647 | ||
| Organism | Salmonella enterica subsp. enterica serovar Kentucky strain KCID6 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2422469..2422572 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2422431..2422574 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NOQ94_RS11775 | 2418855..2419553 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NOQ94_RS11780 | 2419577..2420233 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| NOQ94_RS11785 | 2420341..2420571 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NOQ94_RS11790 | 2420709..2421083 | + | 375 | WP_023205606.1 | CopC domain-containing protein YobA | - |
| NOQ94_RS11795 | 2421084..2421959 | + | 876 | WP_023223935.1 | copper homeostasis membrane protein CopD | - |
| NOQ94_RS11800 | 2421976..2422329 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2422431..2422574 | - | 144 | - | - | Antitoxin |
| - | 2422469..2422572 | + | 104 | - | - | Toxin |
| NOQ94_RS11805 | 2422703..2423050 | - | 348 | Protein_2285 | tyrosine-type recombinase/integrase | - |
| NOQ94_RS11810 | 2423062..2423145 | + | 84 | Protein_2286 | phage tail protein | - |
| NOQ94_RS11815 | 2423319..2425202 | + | 1884 | WP_224157289.1 | NEL-type E3 ubiquitin ligase domain-containing protein | - |
| NOQ94_RS11820 | 2425344..2425872 | + | 529 | Protein_2288 | transposase | - |
| NOQ94_RS11825 | 2426018..2426158 | - | 141 | WP_031607419.1 | hypothetical protein | - |
| NOQ94_RS11830 | 2426324..2426592 | - | 269 | Protein_2290 | hypothetical protein | - |
| NOQ94_RS11835 | 2426632..2426832 | + | 201 | WP_023223931.1 | hypothetical protein | - |
| NOQ94_RS11840 | 2426961..2427380 | + | 420 | WP_023205587.1 | GNAT family N-acetyltransferase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | flank | IS/Tn | - | - | 2425534..2425872 | 338 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T252419 NZ_CP101647:2422469-2422572 [Salmonella enterica subsp. enterica serovar Kentucky]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT252419 NZ_CP101647:c2422574-2422431 [Salmonella enterica subsp. enterica serovar Kentucky]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG