Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2018989..2019134 | Replicon | chromosome |
Accession | NZ_CP101567 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain KP29 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2019025..2019127 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2018989..2019134 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NMY30_RS09910 (NMY30_09895) | 2014119..2016179 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
NMY30_RS09915 (NMY30_09900) | 2016183..2016842 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
NMY30_RS09920 (NMY30_09905) | 2016921..2017151 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
NMY30_RS09925 (NMY30_09910) | 2017264..2017638 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
NMY30_RS09930 (NMY30_09915) | 2017642..2018511 | + | 870 | WP_062955019.1 | copper homeostasis membrane protein CopD | - |
NMY30_RS09935 (NMY30_09920) | 2018528..2018866 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2018989..2019134 | - | 146 | - | - | Antitoxin |
- | 2019025..2019127 | + | 103 | - | - | Toxin |
NMY30_RS09940 (NMY30_09925) | 2019502..2019645 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
NMY30_RS09945 (NMY30_09930) | 2019750..2020718 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
NMY30_RS09950 (NMY30_09935) | 2020875..2021528 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
NMY30_RS09955 (NMY30_09940) | 2021525..2021716 | - | 192 | WP_002911395.1 | YebW family protein | - |
NMY30_RS09960 (NMY30_09945) | 2021814..2022053 | - | 240 | WP_002911393.1 | YebV family protein | - |
NMY30_RS09965 (NMY30_09950) | 2022169..2023602 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T252325 NZ_CP101567:2019025-2019127 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT252325 NZ_CP101567:c2019134-2018989 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT