Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2017922..2018067 | Replicon | chromosome |
Accession | NZ_CP101563 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain KP65 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2017958..2018060 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2017922..2018067 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NMY31_RS09895 (NMY31_09880) | 2013052..2015112 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
NMY31_RS09900 (NMY31_09885) | 2015116..2015775 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
NMY31_RS09905 (NMY31_09890) | 2015854..2016084 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
NMY31_RS09910 (NMY31_09895) | 2016197..2016571 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
NMY31_RS09915 (NMY31_09900) | 2016575..2017444 | + | 870 | WP_062955019.1 | copper homeostasis membrane protein CopD | - |
NMY31_RS09920 (NMY31_09905) | 2017461..2017799 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2017922..2018067 | - | 146 | - | - | Antitoxin |
- | 2017958..2018060 | + | 103 | - | - | Toxin |
NMY31_RS09925 (NMY31_09910) | 2018435..2018578 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
NMY31_RS09930 (NMY31_09915) | 2018683..2019651 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
NMY31_RS09935 (NMY31_09920) | 2019808..2020461 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
NMY31_RS09940 (NMY31_09925) | 2020458..2020649 | - | 192 | WP_002911395.1 | YebW family protein | - |
NMY31_RS09945 (NMY31_09930) | 2020747..2020986 | - | 240 | WP_002911393.1 | YebV family protein | - |
NMY31_RS09950 (NMY31_09935) | 2021102..2022535 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T252303 NZ_CP101563:2017958-2018060 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT252303 NZ_CP101563:c2018067-2017922 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT