Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2099739..2099884 | Replicon | chromosome |
Accession | NZ_CP101554 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain KP72 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2099775..2099877 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2099739..2099884 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NMY33_RS10310 (NMY33_10305) | 2094869..2096929 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
NMY33_RS10315 (NMY33_10310) | 2096933..2097592 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
NMY33_RS10320 (NMY33_10315) | 2097671..2097901 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
NMY33_RS10325 (NMY33_10320) | 2098014..2098388 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
NMY33_RS10330 (NMY33_10325) | 2098392..2099261 | + | 870 | WP_019725445.1 | copper homeostasis membrane protein CopD | - |
NMY33_RS10335 (NMY33_10330) | 2099278..2099616 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2099739..2099884 | - | 146 | - | - | Antitoxin |
- | 2099775..2099877 | + | 103 | - | - | Toxin |
NMY33_RS10340 (NMY33_10335) | 2100252..2100395 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
NMY33_RS10345 (NMY33_10340) | 2100500..2101468 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
NMY33_RS10350 (NMY33_10345) | 2101625..2102278 | + | 654 | WP_019725444.1 | protein-serine/threonine phosphatase | - |
NMY33_RS10355 (NMY33_10350) | 2102275..2102466 | - | 192 | WP_002911395.1 | YebW family protein | - |
NMY33_RS10360 (NMY33_10355) | 2102564..2102803 | - | 240 | WP_002911393.1 | YebV family protein | - |
NMY33_RS10365 (NMY33_10360) | 2102919..2104352 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T252281 NZ_CP101554:2099775-2099877 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT252281 NZ_CP101554:c2099884-2099739 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT