Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2116440..2116585 | Replicon | chromosome |
Accession | NZ_CP101369 | ||
Organism | Salmonella enterica strain SC2014238 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2116480..2116583 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2116440..2116585 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NMU30_RS10615 | 2112866..2113564 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
NMU30_RS10620 | 2113588..2114244 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
NMU30_RS10625 | 2114352..2114582 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
NMU30_RS10630 | 2114720..2115094 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
NMU30_RS10635 | 2115095..2115970 | + | 876 | WP_017441953.1 | copper homeostasis membrane protein CopD | - |
NMU30_RS10640 | 2115987..2116340 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 2116440..2116585 | - | 146 | - | - | Antitoxin |
- | 2116480..2116583 | + | 104 | - | - | Toxin |
NMU30_RS10645 | 2116703..2116972 | - | 270 | WP_023216648.1 | tyrosine-type recombinase/integrase | - |
NMU30_RS10650 | 2117061..2117144 | + | 84 | Protein_2023 | phage tail protein | - |
NMU30_RS10655 | 2117317..2119737 | + | 2421 | WP_024146377.1 | type III secretion system effector SspH3 | - |
NMU30_RS10660 | 2119879..2120420 | + | 542 | Protein_2025 | transposase | - |
NMU30_RS10665 | 2120566..2120706 | - | 141 | WP_001640444.1 | hypothetical protein | - |
NMU30_RS10670 | 2120872..2121141 | - | 270 | WP_077909686.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 2120082..2120420 | 338 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251927 NZ_CP101369:2116480-2116583 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT251927 NZ_CP101369:c2116585-2116440 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG