Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2064910..2065053 | Replicon | chromosome |
| Accession | NZ_CP101365 | ||
| Organism | Salmonella enterica strain SC2014107 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2064948..2065051 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2064910..2065053 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NM059_RS10050 | 2061334..2062032 | - | 699 | WP_000944279.1 | exodeoxyribonuclease X | - |
| NM059_RS10055 | 2062056..2062712 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| NM059_RS10060 | 2062820..2063050 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NM059_RS10065 | 2063188..2063562 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NM059_RS10070 | 2063563..2064438 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| NM059_RS10075 | 2064455..2064808 | + | 354 | WP_000722370.1 | YebY family protein | - |
| - | 2064910..2065053 | - | 144 | - | - | Antitoxin |
| - | 2064948..2065051 | + | 104 | - | - | Toxin |
| NM059_RS10080 | 2065181..2066022 | - | 842 | Protein_1969 | tyrosine-type recombinase/integrase | - |
| NM059_RS10085 | 2066113..2066469 | + | 357 | WP_000003145.1 | hypothetical protein | - |
| NM059_RS10090 | 2066423..2066629 | + | 207 | Protein_1971 | phage tail protein | - |
| NM059_RS10095 | 2066801..2066956 | + | 156 | Protein_1972 | DUF4376 domain-containing protein | - |
| NM059_RS10100 | 2067062..2067394 | + | 333 | WP_031609875.1 | DUF1353 domain-containing protein | - |
| NM059_RS10105 | 2067443..2067552 | + | 110 | Protein_1974 | tail fiber assembly protein | - |
| NM059_RS10110 | 2067643..2067828 | - | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| NM059_RS10115 | 2068071..2068268 | - | 198 | Protein_1976 | tail fiber assembly protein | - |
| NM059_RS10120 | 2068264..2069034 | - | 771 | WP_001652627.1 | transporter substrate-binding domain-containing protein | - |
| NM059_RS10125 | 2069110..2069202 | + | 93 | Protein_1978 | DUF4113 domain-containing protein | - |
| NM059_RS10130 | 2069525..2069653 | + | 129 | Protein_1979 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2043040..2104400 | 61360 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251905 NZ_CP101365:2064948-2065051 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT251905 NZ_CP101365:c2065053-2064910 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
